Transcript asmbl_65633

Sequence
Transcript Sequence for observation asmbl_65633 of TGE0006711:
GCGGTAGCGGCGGGAGCCGAGGCTTGCAGCGGGACTCCCCGCTGAGAGCGCGACGCGGCCTTGAGCGGCAGACGGCGCAGTAGGCCGAGGGGGAGGCGCGGCAGCCGCCCTGGCCCGTCATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAAGCCGGGAGCTGGGCGGCCATTTACCAGGATATCCGACACGAAGCCAGTGACTTCCCGTGTAGAGTGGCCAAGCTTCCCAAGAACAAAAACCGAAACAGGTACAGAGATGTCAGTCCCTTTGACCATAGTCGGATTAAACTTCATCAAGAAGATAACGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGAAGTTACATTCTTACCCAGGGCCCTTTGCCTAATACGTGCGGCCACTTCTGGGAGATGGTATGGGAGCAGAAGAGCAGGGGCGTGGTCATGCTCAACCGAGTGATGGAGAAAGGATCGTTAAAATGTGCGCAGTACTGGCCACAAAAAGAAGAAAAAGAAATGGTCTTTGAAGACACAAATTTGAAATTAACATTGGTCTCCGAAGATATTAAGTCATATTATACAGTACGACAACTAGAATTGGAAAACCTTTCATCTAAAGAAACTCGAGAGATCTTACATTTCCACTATACCACGTGGCCTGACTTTGGAGTCCCCGAATCTCCAGCCTCTTTCCTGAACTTTCTTTTCAAAGTCCGCGAGTCGGGGTCACTCAGCCGGGAGCATGGCCCCATCGTGGTACACTGCAGCGCTGGCATCGGCAGGTCGGGGACCTTCTGTCTGGCCGACACCTGTCTCTTGCTGATGGACAAGAGGAAAGACCCTTCTTCTGTCGATATCAAGAAAGTCCTGTTAGAAATGAGGAAATTTCGAATGGGACTGATCCAGACAGCAGACCAGCTCCGTTTCTCCTACCTAGCTGTGATCGAAGGTGCCAAATTCATCATGGGAGACTCTTCAGTGCAGGAGCAATGGAAGGAGCTCTCCCACGAGGACCTGGAGCCCCCACCTGAGCATGTCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACACAATGGGAAATGCAAGGAATTCTTTCCAAACCACCAGTGGGTAAAGGATGAGTCTGAGGAAGATAAAGAAGATGGCCCCATCAAGGAAGAAACCATAACACCCTTAAGTGTCCCCTGCATGGAACGCACGAGTCAAGACACTGAAGTCAGAAGGCGGGTCGTGGGGGCAGGTCCTGCTCAGGGGGAGCCGTCGCCACCCAAGGAGGAGCAGGACCAGGCTCTGACTCACTGGAAGCCCTTCCTGGTCAACATGTGCATGGCCACGGTCCTCACAGCTGGCGCGTACCTCTGCTACAGGGTATGTTTTCACTGACGGACGTGCCGGCAAGACCACGTGTACAGAAAGCACTGGCCGACAGCCTGGCGGTAGCATTCAGTGCTGTGCAAGGATCTGAGCCAGTCTCAGAAGAAACAGATCAAAGTTTTTTAAAGTCTGGAACTGTGAAGGGCTAACAAGAGAGAATTGAGGATTGATGCACTGGGGTTTTAAGGAGCCCTGTGGTCCCAAGAATACAACAGTCTAATCTCAGGGCCTTAACCTATTCAGGAGTAAGTAGAGAAAATGCCAAATACATCTCTCTCTCTTCATTTTTCTTTCTTTCTTTTTCTTTGTTTTTTTTTGTTTGTTTGTTTGTTTTTTGTTTGTTTTTC