Transcript asmbl_19810

Sequence
Transcript Sequence for observation asmbl_19810 of TGE0004099:
AGCCCACGCAGCCTCCTGCCCGGCCTGTTACCAGGTCCAGCTGACAAATTGACTCCCAAAGGGCCTGGGCAGGTGCCTACTGCTGCCTCTGGACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAGGCTTCCCCTAGCCGTACTCGCTCCCCTGATGTTATTTCCTCAGCTTCCACTGCCCTGTCCCAGGATATCCCTGAGATCGCGTCTGAGGCCCTGTCCCGTGGCTTTGGCTCCTCTGCTCCTGAGGGCCTTGAACCGGACAGTATGGCCTCAGCTGCTTCAGCACTACACTTGCTGTCCCCACGGCCACGGCCCGAGCTTGGGCCCCAGCTTAGCCTGGATGGAGGCCCTGGGGATGGGGATCGGCATAGTACCCCTTCCCTCCTGGAGGCAGCCTTGACCCAAGAGGCTACAGCCTCTGACAGTCAGGTCTGGCCAACAGCACCAGACATTACTCGGGAGACCTGCAGCAGCCTGGCAGAAAGCCCTAGGAATGGCCTTCAGGAAAAGCACAAGAGCTTGGCCTTCCACCGACCGCCTTATCATCTGCTGCAGCAACATGACAGCCAGGATGCCAGTGCTGAACAAAGTGACCATGATGATGAGGTGGCCAGCATTGCCTCTGCTGCAGCGGGCTTTGGCACCAAAGTTTCCACTCCACGGCTTCCTGCCAAGGACTGGAAGACCAAGGGATCTCCTCGGGCCTCACCTAAGCTCAAGAGGAAGGGCAAAAAGGATGATGGGGATTCGACTGCGGGATCCCGGCTCATGGAGCACCAGGTGACAGAGCCCCCTGAGGATTGGCCTGCAATAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAAAAAGAGCTACTGCAGCGTCTGTGCACCCAGCTCGAAGGCCTGCAGAGTACCGTCACAGGCCATGTAGAACGTGCCCTCGAGTCCCGGCATGAACAGGAGCAGCGGCGGTTGGAGCGGGCACTGGCAGAAGGGCAGCAGCGGGGTGGGCAGCTACAAGAGCAGCTGACGCAACAGCTGTCACAGGCACTGTCTTCAGCTGTGGCTGGGAGGCTGGAACGCAGCATACGGGATGAGATCAAGAAGACAGTGCCTCCATGTGTCTCTAGGAGTCTGGAACCCGTGGCAGGCCAACTGAGCAACTCAGTGGCCACCAAACTCACAGCTGTGGAGGGTAGCATGAAAGAGAATATCTCCAAGCTGCTGAAGTCCAAGAACTTAACAGACGCTATTGCCCGAGCAGCTGCAGACACGTTACAAGGGCCAATGCAGGCTGCCTACCGTGAAGCCTTCCAGAGTGTGGTGCTGCCTGCCTTCGAGAAGAGCTGCCAGGCCATGTTCCAACAGATCAATGATAGCTTCCGACTGGGCACACAGGAATACTTGCAGCAGCTAGAGAGCCACATGAAGAGCCGGAAGGCACGAGAACAGGAGGCGCGGGAGCCTGTGTTGGCCCAGCTGCGGAGCCTGGTCAGCACACTGCAGGGTGCCACTGAGCAGATGGCAGCCACTGTGTCTAACAGTGTTCGGGCTGAGGTGCAACACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCAATTTTAGCACAGGTACAGCGCATTGTTAAGGGTGAGGTGAGTGTGGCACTCAAGGAGCAGCAGGCCTCCGTCACCTCTAGCATCATGCAAGCCATGCGCTCAGCTGCAGGCACACCTGTCCCAGCTGCCCACCTCGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCCCTCACGGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGGCCAGGTTTTTGGGCAGCCACCCTGCCCACTCTCCCAGCCCGTGCTCCTTTCCTTCATCCAGCAGCTGGCCTCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCTGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGTTCCGTCATGGCCCAGGTGCGCCAGAAGTTATTCCAGTTCCTGCAGGCTGAGCCATACAACTCACTTGGCAAAGCGGCCCGGCGTCTTAGCCTCATGTTGCATGGCCTTGTGACCCCCACCCTCCCTTAGCAAAGCCTGCCTTGCCCAGGGGTGCAGTGGCATTGAAGACCAGCAGACAGGCCTAGACCAAAGCAGGGTCATGTCTGCCCTTTATCTGCTCAGGCTCCCACCTCTGGGGTAGTTGAGAGGGGGAACACTGGCTGTAGTCTACAGGTTATGGTAGCCAGCAGGTTTAGGCTGAGCCCAGGGTGGGTATTGTGCCTTCTTGGGTTCTGCCATGCCTGGAGCATGACCCCCTGAGATTGTGATACCACTTGAGTTGAATTTTCCATGTTCCTTTTTACCTCTGTTTTGGATCTTTCTGTTTTTGAAAAACATTGAGAAATTCAATTAAATGCTTTTGGAATAAAA