Transcript asmbl_65255

Sequence
Transcript Sequence for observation asmbl_65255 of TGE0006647:
AAACAACCTCCGGCGACAGAGCCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGAAATGTACACTTTGCAGTCAGCCCGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTGTATTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGGGGAAAATTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAGAGCTTCTAGCAAAATGATTGGATCCTTTCGAGTTTAAACTAACATTTGGCGACAGCAAATTAAACCTCTTTAAGACTCACTAAGGACTTTAGCCACCATGTCTGAAACCTGTTCCTCTCAAGTGCCGTGTTGTGTGGAACACTTCTTATATTGGCCCAAAGTATGTAAGGAGGTCTCATGTGCTCTAGGAGTAAAAAAACAGTCTTCGCATAAAACAGTATTTATTTTTAATTTTGTGACCACTATTTTAGAAACTTTATTTAATGTTTTTAATGTTTCATTCAGTGCTTTGCTTATCTAGTAAATAGGCTTTTGTGCCCTACTTTTCCTCTGGTAGGGCTTGCTGTTGTACTATTGATCATCAGAATTGTTTCTCAAAGCCTAAGAACCCAGCATTTTAGAAAGGATTTTCACACTGGCATTTCTAGCTAGTGTTATTTTCTTCCACTTACTTGCTGAAGCACATTTATATATTTCTTCATGGCAAAACCAAAAAACTTTAGTTGTGGTCTGCCTAATATTACCAT