Transcript asmbl_65233

Sequence
Transcript Sequence for observation asmbl_65233 of TGE0028415:
ATACTGTCTGTCAGTATTCTTATTCTTTGCCAATAATGCGAAAGGGCCTGTGGTTCCGACTGAGGAAGATACTTCTCTATGTTTTGGGGTTATACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGGATACAGGCCAAACTGATTTTCTTGAATTTTGTGAGGGTTCCCTATTTCATTGACTTGAAAAAACCACAGGATCAAGGTTTGAATCACACCTGCAATTACTACCTCCAGCCAGAGGAAGATATAACCATTGGAGTCTGGCACACTGTCCCCACTGTCTGGTGGAAGACTGCCCAAGGGAAGGACCAGATGTGGTACGAGGATGCCTTGGCTTCCAGTTACCCTATCATCCTGTACCTGCATGGGAATGCAGGTACCAGAGGAGGTGACCACCGAGTGGAACTTTACAAGGTGCTGAGTTCCCTTGGTTACCACGTGGTCACTTTTGACTATAGAGGTTGGGGTGACTCAATAGGCACGCCATCAGAGCGGGGCATGACCTATGATGCACTCCATGTTTTTGACTGGATTAAAGCGAGAAGTGGAGACAACCCCGTGTATATTTGGGGCCACTCCCTAGGCACTGGAGTGGCAACAAATCTGGTGCGGCGCCTCTGTGAGCGAGAGACACCTCCAGATGCCCTAATATTGGAATCTCCATTCACCAATATTCGTGAAGAAGCTAAGAGCCATCCGTTCTCAGTGATATATCGATATTTCCCTGGATTTGACTGGTTCTTCCTTGATCCCATTACAAGCAGTGGAATTAAATTTGCAAATGATGAAAATGTGAAGCACATCTCCTGCTCCCTGCTCATCTTGCACGCTGAGGATGACCCAGTTGTGCCCTTCCAGCTTGGCAGAAAGCTCTACAACATTGCTGCACCCTCTCAGAGCTTCCGAGACTTCAAAGTTCAGTTTATCCCCTTTCACTCAGACCTCGGCTACAGGCACAAGTACATCTACAAGAGCCCTGAGCTTCCTCGAATACTAAGGGAATTCCTGGGGAATTCGGAACCTGAGCACCAGCACTGAGCTCACTGCTTGAAGGAGCATGAAGACCTTTGCCCTCCTCCCCATTCCTCCAGCCAACCCAGCACCGTGGAGCAAGGGTACCAGCGTCTGTGATGCACCTGGAGAGAGGACTCGGATGCCATCTAGGGCAGGAAGAGGAGGCCACAGCAGACTGGTGGCCAGGAGCATAGATCTTTGTGGAAAATGCGAGTGGCAGGCATGTGGCCCTCTCTCCCTCTTGCTGCCACTCAACCTGAGTTCTTGGAAGGACAGTGACACAGCAGGCAGCAACCAGCAGGTCGATCCCACACTTCTTGAGCTGGGTATGGAGAATGAGGCAGGAAGTATGAAGTCTTGGGACCACACTGAGCTATCCGGTACCACCCATGAGAATGTGAGGACACTTGGGTTCTTCTGTCCCTTCCCAGCACATGCAGAATGGACTCTGTTGGTTCCATAGCCCCTTCCTGCCCTCTGCACCCCCACTTGCCTTCCTTGGTGTCCCTGCCTCCCTTGGCAGGCCCACCACTCACAGAGAGGGAAGTGCCCACGATCTGCACTTCCTCCACTTTCCACCCACCTGTTCACCTGAGCGTTTATTTA