Transcript asmbl_17266

Sequence
Transcript Sequence for observation asmbl_17266 of TGE0000416:
CCCAGTCTCGCGCCTGCAGCCCGTGCCGCCCCAGCCGCTGCCGCCTGCACCGGACCCGGAGCCGTCATGCCCAAGTGTCCCAAGTGCAACAAGGAGGTGTACTTCGCCGAGAGGGTGACCTCTCTGGGCAAGGACTGGCATCGGCCCTGCCTGAAGTGCGAGAAATGTGGGAAGACGCTGACCTCTGGGGGCCACGCTGAGCACGAAGGCAAACCCTACTGCAACCACCCCTGCTACGCAGCCATGTTTGGGCCTAAAGGCTTTGGGCGGGGCGGAGCCGAGAGCCACACTTTCAAGTAAACCAGGTGGTGGAGACCCCATCCTTGGCTGCTTGCAGGGCCACTGTCCAGGCAAATGCCAGGCCTTGTCCCCAGATGCCCAGGGCTCCCTTGTTGCCCCTAATGCTCTCAGTAAACCTGAACACTTGGAAAACC