Transcript asmbl_63939

Sequence
Transcript Sequence for observation asmbl_63939 of TGE0001320:
CTCCTCCTCCTCCTCCTCCTCCTCGCGTTAGTTCCGGTCGCAGAGGAGAGACCGCCGCAGTTGTCGCCACATCGCGGATTTCTGGCTCTTTTCTCTTCGCCTTAAATTCGGGTGTCTTTTATGAATAATCAAAAGCAGCAAAAGCCAACGCTATCAGGCCAGCGTTTTAAAACCAGAAAAAGAGATGAAAAAGAGAGGTTTGACCCTACTCAGTTTCAAGACTGTATTATTCAAGGCTTAACTGAAACTGGTACTGATTTGGAAGCAGTAGCAAAGTTTCTCGATGCTTCTGGGGCAAAACTTGATTACCGCCGATATGCAGAAACACTCTTTGACATTCTGGTGGCCGGCGGAATGTTGGCCCCAGGTGGTACACTGGCAGATGACATGATGCGTACAGATGTCTGTGTATTCGCAGCACAAGAAGACCTAGAGACCATGCAAGCATTTGCTCAGGTTTTTAACAAGTTAATCAGGCGTTATAAATACCTGGAGAAAGGTTTTGAAGATGAAGTGAAAAAGCTGTTGCTGTTTCTAAAGGGTTTTTCGGAGTCAGAGAGGAACAAGCTGGCTATGTTGACTGGTGTTCTTCTGGCTAATGGAACACTTAATGCGTCCATTCTTAATAGCCTTTACAATGAGAATTTGGTGAAAGAAGGAGTTTCAGCAGCTTTTGCTGTAAAGCTCTTTAAATCATGGATAAATGAAAAAGATATCAATGCAGTAGCTGCAAGTCTTCGGAAAGTCAGCATGGATAACAGATTAATGGAACTTTTTCCTGCCAATAAACAAAGCGTTGAACACTTCACAAAGTATTTTACTGAGGCAGGCTTGAAAGAGCTTTCAGAATATGTTCGGAATCAACAAACCATAGGAGCTCGTAAAGAACTCCAGAAAGAACTTCAAGAACAGATGTCCCGTGGTGATCCATTTAAGGATATAATTTTGTATGTCAAGGAGGAGATGAAAAAAAACAACATCCCAGAACCCGTTGTCATTGGAATAGTTTGGTCCAGTGTAATGAGCACGGTAGAATGGAACAAAAAAGAGGAGCTTGTAGCAGAGCAAGCCATCAAGCACTTGAAGCAATACAGCCCTCTACTTGCTGCCTTTACTACTCAAGGTCAGTCTGAACTGACTCTGTTACTGAAGATTCAGGAGTATTGCTATGATAACATTCATTTCATGAAAGCCTTCCAGAAAATAGTGGTGCTTTTTTATAAAGCTGAAGTCCTGAGTGAAGAACCCATTCTGAAGTGGTATAAAGATGCACATGTTGCAAAGGGGAAAAGTGTCTTCCTTGAGCAAATGAAAAAGTTTGTTGAGTGGCTCAAAAATGCTGAAGAAGAATCTGAGTCTGAAGCTGAAGAAGGTGACTGAATTTTGAAACTACACCCTCAGTAAAGCAAACAGGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATCTTCCTACCTCCCTATATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTACTGGATATGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTTTTTTCAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTTTCCCTGGGTTTTCTATATAAACAGTTTTCAAGATATGATTTGGTTAAAAATAATTTGTTATAAGAATTTTGTTTGCAAATTAAACTGTAAAAGTATCCAAAGTCTCAAAAGGCAATGATTTGTGTGATAATTTGGTATGCCCAAAGCCCTCCTCATCAATGACAGTCTCATACAGTGATTGAATTCATTAACATGAATCTTGAGTATTTGAACCATTGCTTACATATTAATATTTTCTTGCATTTTTAACCCCAGATGTCCTCGAGTTCAGTTGTTTGCTCTCTGGTTTTCATTCCTTGGTAAAGCCATGGAGAACAATCTTGAAAGTGAGGTCTCTGGGAAATTGTATGTGGCAGATGTGATAGGAAGAAGAAAGTTGAGCTTTTTCCCATTGAGAAACTTCTGCATTCAGTTTGTGTCTTTCCAGGAAAAGCAAATGGGTATTTTTTTCATACCGTTTTCAACTGTACCTTAAAAAGTTTTGTCATTTAACGAATTTAACACTTGTCATATGTTTAGATAGGAAAGGACTCATGAAATAGTGAATAAAGAAAATGACTGTTGAAATGTTAAGTGATCAGCATGGTCTAATTGGGAACTCTTAAATATAACTCATTTCCTGTGGGTTAAGCGTATTTGATGTAAAGAATGGAGTGTAATAATGATATATTCCCACTTGGTCATATAAGACCAGCTTCATTCTTGTAACATTAACAAATGATTCAAGCATCTGACTATTAACATGCCCTAGTT