Transcript asmbl_63870

Sequence
Transcript Sequence for observation asmbl_63870 of TGE0028382:
GCAACGGGTAGTTGTGCGACAGCGGCGGTGGGGGCACGGCGGAAGCGAGGAGGACCGAAAGGGACCTGGGCCTGACTCCCGCGCCAGGGTGGAGCACCATGGACGAAGCAGGCAGCTGTGCGAGCGGTGGAGGCTTCCGCCCGGGCGTAGACAGCTTGGACGAGCCGCCCAACAGCCGCATCTTCCTGGTGATCAGCAAGTACACGCCCGAGTCGGTACTTAGGGAGCGCTTCTCACCCTTCGGCGAGATCCAGGATATCTGGGTGGTACGGGACAAGCACACGAAGGAGTCCAAGGGCATCGCCTTCGTCAAGTTCGCTCGCAGCTCGCAGGCCTGTAGGGCCATGGAGGAAATGCATGGCCGGTGCCTGGGCCCCAACGACACCAAGCCTATCAAGGTCTTCATTGCTCAGTCCAGATCATCTGGAAGTCACCGAGATGTTGAAGATGAAGAGCTTACAAGAATCTTTGTTATGATACCAAAGTCCTACACAGAAGAAGACTTACGGGAAAAATTTAAGGTGTACGGAGATATTGAGTATTGCAGCATTATTAAGAATAAAGTCACTGGAGAAAGTAAAGGTTTGGGCTATGTTCGTTACTTAAAACCATCACAAGCTGCCCAAGCAATAGAAAACTGTGATCGAAGTTTTAGGGCAATCTTGGCTGAACCCAAAAATAAAGCATCTGAATCCTCGGAGCAAGATTATTATAATAATATGAGGCAGGAGACTTTGGGACATGAACCTAGAGTAAATATGTTTCCATTTGAGCAACAACCTGAATTTTCAAGTTTTGAGAAGAATGACAACAGAGGCCAGGAAGCTATCTCCAAACGCCTATCAGTTGTATCAAGAGTTCCTTTCACCGAAGAGCAGCTTTTCAGCATTTTTGATATAGTACCAGGATTGGAATATTGTGAAGTTCAACGAGATCCTTATTCAAATTATGGTCATGGAGTGGTTCAGTATTTTAATGTAGCATCAGCTATTTATGCAAAATACAAGTTACATGGATTTCAGTATCCTCCTGGGAATCGGATAGGTGTTTCTTTCATTGATGATGGGAGTAATGCAACAGATCTCCTTAGAAAAATGGCAACGCAGATGGTAGCTGCACAGCTTGCATCAATGGTGTGGAATAACCCAAGTCAGCAGCAATTTCTGCAATTTGGAGGAAGTTCTGGATCACAGTTGCCTCAAATTCAGACAGATGTTGTACTTCCATCATGCAAAAAAAAAGCCCCTCCTGAAACTCCTGTGAAAGAAAGACTTTTTATCGTGTTTAATCCTCATCCTTTACCTTTAGATGTATTAGAGGATATATTCTGTCGTTTTGGTAACCTGATTGAAGTTTACCTTGTGTCAGGAAAAAATGTGGGATACGCCAAGTATGCAGATAGAATAAGTGCTAATGATGCGATTACTACTTTACATGGGAAGATCC