Transcript asmbl_63839

Sequence
Transcript Sequence for observation asmbl_63839 of TGE0006588:
CTCGCCGTAGCAGCCGCCGCCCATCCCTCTTTGTGTGTTTCGGGAAGCCGCAGAGCTAGTGGCGGTGACTCTTGGCATTGGGGGTGAAGGAAAGGGACGTTACAGGGAACTTGCAGGCGGCAGGACTCTTCTCCATCCCGCCACTTGACAGGTCACAAACATGTCAGACAAAAGTGAATTAAAGGCAGAGTTGGAACGGAAGAAGCAGCGGTTGGCCCAAATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAGGAAACTGATCAGAAGAAAGAAGCAGTTGCTCCTGTACAAGAAGAATCAGATCTCGAAAAAAAAAGAAGAGAAGCTGAAGCACTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTCCCTCCTCCTATGTCTCCATCCTCCAAATCTGTGAGCACACCAAGTGAAGCTGGGAGCCAAGACTCTGGAGATGGCGCAGTGGGATCTAGACGAGGACCTATTAAACTTGGAATGGCTAAAATTACACAAGTTGACTTTCCTCCTCGAGAAATCGTGACATATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCCAAAGAAGATGAAGAAGAAGAAGATGATGTGGTGACTACTAAACCACCTATTGAACCTGAAGAAGAGAAGACTTTAAAGAAAGATGAGGAAAATGACAGTAAAGCTCCCCCTCATGAGCTGACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAAGAATTTTTAAGTTTCTTTGACCATTCTACACGAATTGTAGAAAGGGCTCTTTCTGAGCAGATAAACATCTTCTTTGACTACAGTGGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAATCGACAATTTTTTGATGAACGTTGGTCAAAGCATCGGGTTGTTAGTTGTTTGGATTGGTCATCTCAGTATCCAGAGTTACTCGTGGCTTCATATAATAACAATGAAGATGCTCCTCATGAGCCTGATGGTGTGGCCCTTGTATGGAATATGAAATATAAAAAAACTACCCCGGAGTATGTGTTTCACTGCCAGTCAGCTGTGATGTCTGCTACATTTGCAAAATTTCATCCAAATTTGGTTGTCGGTGGTACATACTCAGGCCAAATTGTGCTGTGGGATAACCGTAGCAATAAAAGAACTCCAGTGCAAAGAACTCCACTGTCAGCTGCTGCACACACACATCCTGTATATTGTGTAAATGTTGTTGGAACGCAAAATGCTCATAATCTGATTAGCATCTCTACTGATGGAAAAATTTGTTCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAATTGGTTCATAAACAGTCAAAGGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTTGTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGTCGCCATGGCAGCAAAGCTGGAATCAGTGAGATGTTTGAGGGACACCAAGGACCAATCACTGGCATCCATTGTCATGCAGCCGTTGGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCATTTGACTGGACAGTAAAACTTTGGACAACTAAGAATAACAAGCCTTTATACTCATTTGAAGATAATTCAGACTACGTTTATGATGTTATGTGGTCACCCACCCACCCAGCCCTCTTTGCCTGTGTGGATGGCATGGGGAGGCTAGATTTGTGGAATCTCAATAACGACACGGAGGTGCCAACTGCCAGCATTTCCGTGGAGGGTAATCCTGCTCTTAATCGTGTAAGATGGACCCATTCTGGAAGAGAGATTGCCGTGGGTGATTCTGAAGGACAGATTGTTATATATGATGTGGGAGAGCAAATTGCTGTCCCCCGAAATGATGAATGGGCACGGTTCGGCCGAACACTTGCAGAAATTAATGCAAATCGAGCTGATGCAGAGGAGGAGGCTGCTACCCGAATACCTGCGTAGCTCCTGAAAATGGGATATGTAGCCTTAGTGGATTTGGGGAAGACTTTAAGTAGATCCTGAGACTATTTGCATGCTTCTGTCTAAATGATAATTAAAAGGAACTTTGGTGGATTAAACCATGGATTTAATGCAGCAAGCAATTCTTACAATGTCCCTTTTTATATAACATGCATCCTGTTTTGGATTTATGTCATTTTTAATACAGCTTATCGACTTTACTGAATGCAGCCTCTTTTGAATTCTTATACACAGGTGTATATTTGGTATTAGTTATTATTTTGAATTATTTTCAACTTATAACACTATATACAGTTATTTCTAAAGCACAAATTAAATAACTTCTGCATATTTTTAAGTAATCATAATTCCCTGTTATACTGATAAAGTTCTAACTTAATATGTGGGAACATTGTTCATTCTTAGCCATAGCATGCATACATCTATCCAAGTTATGTTCTAATATCTTTTTTCTTCTTTATAATTCATGTGATAGCTGTATATAAATAAAAAC