Transcript asmbl_63679

Sequence
Transcript Sequence for observation asmbl_63679 of TGE0006559:
AAAGCCGGGAAAAGGAAAACCCTGCCCTGCGAGTGTGGGTCAATGCGTTTTTGCGGAGGAGGTGTTGGACTGCTAGGGCCCCGCTGAGATTGTCAGTTTGCGCGCTTTTGAGTTTAAGCGTGTGTGGCTGTGGCGACCCCCAGCGCGTCGCCAGCGTACCTTCCTCTGCAGGAGATAAACTGCACTCAGCTGAGTGCAAGATTAAGAGGAATTGATTAGAAGTTGACTCTAAAGGTTTATTGCAGTCAAAATGTCTCAAAAAATCCGTGGTGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAGTTGATTAAAGAAAAACTCATTTTTCCATATGTGGAATTGGACCTGCACAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAATGACCAGGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGTACAATGTTGGTGTCAAGTGTGCTACCATCACCCCCGATGAGAAGAGGGTTGAGGAGTTCAAGCTGAAACAAATGTGGAAGTCACCAAATGGCACCATTCGAAATATTCTGGGTGGCACTGTCTTCAGGGAAGCTATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCCATCATCATAGGTCGTCACGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGTCCTGGAAAAGTAGAGATAACCTACACACCAAGCGATGGATCCCAAAAAAAGACGTACCTGGTTCATAACTTTGAAGAGGGTGGTGGTGTTGCCATGGGGATGTACAATCAAGATAAGTCAATCGAAGAATTTGCACACAGTTCTTTCCAGATGGCTCTGTCTAAGAGTTGGCCTTTATATCTGAGCACCAAGAACACTATTCTGAAGAAATATGATGGACGTTTTAAAGACATCTTTCAGAAGATATATGACAAACAGTACAAATCCCAATTTGAAGCCCAGAAGATCTGGTATGAGCATAGGCTCATCGATGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGTTTTATTTGGGCCTGCAAAAACTATGATGGTGATGTGCAGTCAGACTCCGTGGCCCAAGGTTATGGCTCTCTTGGCATGATGACCAGCGTGCTGATTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCATGGGACTGTAACACGCCACTACCGCATGTACCAGAAGGGACAAGAGACATCCACCAATCCTATTGCCTCCATTTTTGCATGGACCAGAGGGTTAGCCCATAGAGCTAAGCTTGATAACAATAAGGAGCTTGGCTTTTTTGCAAAGGCTTTGGAGGAAGTCTGTATTGAGACCATCGAGGCTGGCTTCATGACCAAGGATTTGGCTGCTTGTATTAAAGGTTTACCCAATGTGAAACGTTCAGACTACTTGAATACATTTGAGTTCATGGACAAACTCGGAGAAAACTTGAAGACAAAACTAGCTCAGGCTAAACTTTAAGGTCATTCCTTGACTTGGGAGGACACGTGTTTTTTTGGTAATTAGGTCCACTGGTTTACATTTTTCTGTATAACACTCAAGAGTATGGGCAAAATCAATTTTCTAATTTGTTTAGAAGTCAGAGTTTATCTTTTCTATAAGATTACAGTCTTTTTCTTATACATACAATTATGCCACCTTCATGAATGTGGCTGGGAACTTTTTAAAATTTTATTTTCTATTAGTAGCTTAGGAATTACTTTAGTGCTGATTTGTACTCACTGTCACTTTTTCTCATGTTCCAGTATAAATGACCAAAATGAAGAGTGCTCGAAAGGGTAAACTATAGCCATGGTATTAGTCCCTAAAATTGTATAAAGTAGAAATTCGCTCCCTTCCCCACTTTTCCATGGCCTGGGGCTCTGGGTGGTTTTGCTGTAACAGGTGTCCCATCCTGTGTGGTAGAGCTGTACCTTAAAAGTTGCCCATGAGTTGGAATGAAGAGCATGGTTATAACTAAGACACAGCAGTCATATATGTAAAGAGCTCTGATTGAACGTTTCGAAAAGGCTAAAGATTTTTGAAGCCACTAAGAGTGTTTGGAATCTAGAATAAATACTACTCGGGGGTTTGTCCTCTGCGTTTGTCTCCTCCTCCTGGCCCTGTGTGGCTTAAGTATTATACTGCCCTGAACAGCATATTTCATCTAAGTGCAATAATACAAGCTGCACCTTTTTTGTACTTCTGCTGGCCTGTTGGGTTTTTTTTTTATATAAATGTGACTTTTTAGAAATTTGTTTTAAACACTATACTAGTCTGTTCTTCATCTAAACTATTAATTAAAGTTAAGTGCTAATGA