Transcript asmbl_63592

Sequence
Transcript Sequence for observation asmbl_63592 of TGE0010383:
GCTAAACCTGCAGGAAAGTGCCCTGGGCTGGGGAGAATGTGGTTAGGAAGTGTGAGCGGACTTCTGAACTCTGAGTAGTTCTCAGTTCTGTAACCTTCGCCTCCCACTGGGTGGAGTAGGGCTTTTAAGAGCAGCTGGAATGCAGTTCCCCAGATCAGTGTAGCCAGTTGTTGCCTGTCTGAACTTCTGCCAGTCCTGGAGAGGTGCTCTGAGCTCAAACCAGCCGGCCTTGCTCTGCACTCCTCACCGCTGTCCCCACTGGAGCAAGAAGAACGTTCCCACCTGTCCAGCCATGGGGGAGGACGCTGCACAAGCTGAAAAGTTCCAGCAGCCGGGTTCTGGCTTGCGGCAGGAGAGGCCAGCCAGCCCCAGCCCAGTGCCTTCCTCCACACCAAGCCCCAGCCTGAACCTGGGGAGCACAGACGAGGCCATTCGGGACAACTCGCAGGTGAACGCCGTCACGGTGCTCACACTCCTGGACAAGCTGGTGAACATGCTAGATGCCGTGCAGGACAACCAGCACAAGATGGAACAGCGGCAGATCAGCCTAGAGGGCTCTGTGAAGGGCATCCAGAACGACCTCACCAAGCTCTCCAAGTACCAGGCCTCCACCAGCAACACGGATGAAAATGAGATCCCTGCCAGTGTGTTTGTGAAAGAACCAGCTTCCAAGCCAGTGGAAGGGAAGGACGACCTCGCTGATGAAAACAAGTCCCTGGAGGAAACCTTGCACACGGTGGACCTCTCATCCGAGGATGAATTGCCCCACGACGAAGAGGCCCTGGAAGACAGTGCAGAGGAAAAGATGGAGGAAAGCAGGGCAGAAAAAATAAAAAGATCCAGCCTCCAAAAAGTGGATAGCCTCAAGAAAGCATTTTCTCGCCAGAACATCGAGAAAAAGATGAACAAGCTGGGGACGAAGATTGTATCTGCAGAGAGGAGAGAGAAGATTAAGAAATCTCTCGCTTCCAGTCATCAGAAAATATCCTCAGGGAAAAGCTCCCCCTTCAAAGTCTCTCCCCTCACTTTTGGTCGAAAGAAAGTCCGAGAGGGAGAAAGCACGACAGAAAATGAGACCAAGTCTGAAGACATGCCTAGCAATGACCAGATGCTGAATGATCACGAGGAGAGCTCCTTCGCGGAGGGTCATTCCGAAGCATCCCTCACCAGCGACCTGGTGGAAGGGAAGGGAGCAGAGGGAGATGCTGGGAGGGCGGCCTCCAGAGGGAGTAACTCTGGCATGGACAGCAACGTGGACTTGGCTATTGTGGAAGATGAGGGAGAAGAGTCGGTGGCCCTGGAACAGGCACAGAAGGTGCGCTATGAGGGAGGCTACGTGCTGGCCTCTGAGGACGCTGAGCAGTCAGATGAAGAGCCGGTGAAGCCAGCTGTTCTCCAGGTGGACCAAACTGCCTAAACAGCACAGGCTGCTGTGCGGGTCCTGTGCCTTCACTTAGATCAGGAACCAGGGCTTAGAACAAACTCCTGCACATCAGCATCTCCAGCACCATCCACTCGCTACTTTGTTATTGTCCAAGCAGTAATCATTTACTACATAGCAGCAGCACACACGTGACCAAGATTTACTGTGAAGGCAACCCGTCAGGGGCTCCCTTTTAATTTGCTCTTAGGTTCTGTTTCTGTAGAATTTCTCCAACATTGCCCAGAAGAAGAAATGGAGCAGTTAAAAAACGCTGACCAATTTGGCTTAGTCAGAAAAACCATAGGCTACTTAGGATGCTAGTCATGAAATGTGATTAATTTTTTTGTCATTCCATAAGCTTGTAGGATAGAGTACCAGTAAAATATTGAATTTCCTCAGAACTCTGTGAATCTAAGTGTGTGATATATAATATACAAATGTATTTAAGCTAAAGATGTAACTACTTTATATTTTAAGAAGAAAACATTTTTTTAAAAGGTAAAAGAGGAATTTCAGTTGGCCATCCACTTAATAGAAGCCATCGTTTATGAAAATGAAGTAAAAATTGAAAGATTGTAATATTTATCTAGTGCAGTAAGATATGTAGAAAAGTCAGGACTATTGGGAAAAGGAAACTAAGGAGATGTTGGAAAATAAAAGAAACAGGAAGCAATGCCAATGAGAATGAAGACAGAGAAAAAAGTATGTGCTTGAAATAGAATATTTACAATATTAGATTAAGTATTTCACTCCTTAAATAACAATACTAAAGACATTCATATATCTTAGAATAATGTCACGATATTTTTCTAACATTTTCAAATAATATAAAAAACACAATTACTATGTTAAAGCTGCATTTTTCTTAATAAAAGATATTACAAATATTTCTTTAAGGAAACTCAAAAGGATGTCTCTTTAACATTAGAATGAACATAATTCTTCAAAATTAATTAATACACACTGCCTTTTCTAAGAAGTTGGATCATACTATTCTTTAATGTTTTTCAAATTCAAAATAACCCTTATACTCCAAATGTAAGTTTATAAGATGTTAAAATCAACAGATTTGGGAAGGGAAGTCTGTTTTTCCTTTTTTATACATAATGGTAATTTTATTCCAGGTCATATTTTATTTATATATTAATTTCACAGAATTTTAATGTTTCTTAACTTTTTAATGCATGCTAGTGTTTATGTATATGTGAACGTTTATTTAGATGAGGTAATTTTTACTACTGCCTAACATTATACTAAAATATTGCTTCATCTGTTTTAATTATGGAATGCTACTATTTTGAGGAAACTATTAAACTATACTTTAAAGACAGGTAGCAAGCAGCAAATTCCCTAAATTTAGTATGTACCACTCATTATAAGTACCTTCACAAATACAGGTAGTCCAAGACAGTATTAACAAACTGCTTTGTCTTATGAAAAGGATAGGATTAACCAATGTGTCGATGACATAACTCTACAGCTATGTCCTTATTTTGCAGTAATGTACCCCAATATTAGATTGCTGAACTAACAGCAGCTATGTTAAAGAAGACTAAATAAACCTAAATAAAAAGCACATAACAATGTCAGTTTTTTGGCAGAACAATTTTAGAACGAGCAGAAAGAATTGATTTTAAACTCTCCTCCAAACATAGCTGTAATGTTGATTGTTTCAGTCTTGATTTCCCTATTAACTCTGTTTCTCTTTTCCCTGATCTCATTTAGAAATCCAAGTCTCATTCTTCAAGTTTAACTTTCTTGACATCACCTTGCCAGCTCTGGAGAGCATCTGAATTTGTTGCAGCAGCTTGATGAATTTGATAGTTCCTTCTGCATTTTTATTGTTTGGTACCAGACCTTATAATACCTTAAGTGGCC