Transcript asmbl_19728

Sequence
Transcript Sequence for observation asmbl_19728 of TGE0004088:
TAAACTTTTGGAGAAAAAAAAAAGATGAACGAGCTCGCATCCGAGTGGAGCATATTATACGAGAAGACTACCTTGTGGAAGCCATGGAGATCCTGGAACTCTATTGTGACCTGCTGCTGGCTCGGTTTGGCCTCATCCAGTCAATGAAGGAGCTAGATTCTGGTCTAGCTGAATCTGTATCTACACTTATCTGGGCTGCTCCTCGACTTCAGTCAGAAGTGGCTGAGTTGAAAATAGTTGCTGATCAGCTCTGTGCCAAGTATAGCAAGGAATATGGCAAGTTATGTAAGACCAACCAGATTGGAACTGTAAATGACAGGTTAATGCACAAACTGAGCGTGGAAGCCCCACCCAAAATCCTGGTGGAGAGATACCTGATTGAAATTGCGAAGAACTACAATGTGCCCTATGAGCCTGACTCTGTGGTCATGGCAGAAGCTCCCCCTGGGGTAGAGACGGATCTTATTGACGTTGGATTCACAGATGATGTGAAGAAAGGGGGCCCTGGAAGAGGAGGAGGAGGGGGTGGGTTCACAGCACCAGTTGGTGGACCTGTTGGAACAGTGCCAATGCCTATGCCCATGCCCATGCCATCTCCAAATACTCCTTTCTCATACCCGCTTCCAAAGGGACCATCGGATTTCAATGGATTGCCAATGGGGACTTATCAGGCCTTTCCCAGTATTCATCCACCTCAGATACCAGCCACTCCCCCATCGTATGAATCTGTCGATGACAATGCTGATAAGAATGTCTCTTCTGCACAGATTATTGGTCCTGGACCCAAGCCAGAAGCCTCTGCAAAGCCCCCTTCCAGACCTGTGGATACCTACGACAACTTTGTACTACCAGAGTTGCCATCTGTGCCAGATACACTACCAACCACATCTGCTGGTGCCAATACCTCAGCATCGGAGGACATTGACTTTGATGATCTTTCTCGGAGATTTGAAGAGTTGAAAAAGAAAACATAGGCCTCTTAAACCAGGCAAGTTTGGGAGTTGAGACCGAGCAGTTTCTCCTTGTAACAAAGAATCTCCATGAAATTCCGTTTCATCTCTTAACCATTACGGAGCACACTCTTCCTCTGGGCTCTCTTCCTGCTCTACCAAATTCTGCTGCTTTCCAGTTCTTTATTGCTCCTAAGAGACGAACGACTGAAGACACTATGAGGCCGAAGCAGCTGTCTCCTGTGAGCTGTGCTTACCCGTTTCCCATCAGTGAGATCCCAGGTTCTCGCCTCACCTGTTCCACCATCCCTCCACAGGGGAGTGAGAAGGTAAAAGCATTGTGGGAAAAGCTGCCAAAGATGGCTGGACACTGGAAGAGAGTACTTCATGAAGTATCCCCACCTCGTGCTGAGGTTCTAGACTTAGAAACAGTTCTCTCTGTGTAGAGGGATTTGTGGTGAGTGAGAATCAAGGCCAAGGTGTGTATTTTTTTCCACTCATATGAATGGGAGAGAGAAAATGACTCAGGAAGCCACTGTAACAGTCCTTGGAAGCTGGGTCCTCTCATTGGCTTATACACTACTCCTTGCTGCAGGGCACAATTCCACCTGGGTCCAGTTTATTTGGAAAGTTGAAGTCCTCTCAGTTCTGCTGGATTCTCAGGGAGCCCTCTGTGGCCTTTTGCTTTATTTGCGTGCTATGTTTCCCTTTTACCAGAGGGCAGCACTGTATAAATTCCTGTTGTTCCCATAGCATGTTCTGTTAGACTGCATTACTGATGAAGGATAAGTCACATATTGGGCACTTGTCACCATTCAAGGCTAAGGTGGGCTTCCAGTTGCCTTAATAAAAGTATTCAAGTCTCTTGAATAGTGAGCTGGAAAGCCTAAAGAGAAGAGGGGTTCCTGTTTTCATTTGAAAACTTTATATGATTAAGAGAACCTTTAAAAAGTGATGTCAAGATTTTGGTGCCCATGTGGCTAGTTGTTTGCAGCTTTTCTCAATGGATGAGACTCTTACTCTTCTAACTTATGTGCTCCTTTGTCCCCTAGCTAAGGCCATCCTTTCCCACAGGTTTGGCTTTGGGATCAGAAGATATGACTTTGGCTTCTGTTTATCTGTACATATCTGTTTCAAGTATCTTTTCTTTAATGGTTCTGATTGGTTTGTATCATAACTTAGTAGCTGATAATAAAGTTAAAAATTCTGTGC