Transcript asmbl_63435

Sequence
Transcript Sequence for observation asmbl_63435 of TGE0006524:
GTTTCCTTCTCTCATTGAGAAAGAAGAGGATTGGAAGGCCGAGCGTATAAAGCCGCGCAGAGAGCGTGAAACAAAGCAGTCGGATCGGAATTGGACTTGGGGTGCGCCGTGTGGAGTCAGGCATAAAACTTGTTGGAGGGGAGTAACGAGCCTGCTCCTCCAGCTCTCCTCATCTGTGCGGGTTCCCACCAGCCTTGCGATTTATTTTTATATCTGCTTTTTTTATATATAGAGAAATATATATACATATATATTTTTTTCCCCATAAGAGAAAATTTCTGTTCCAAGAGAAAATAAGGCAAGATCAATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAGTAAATCTATCATGGATCCTAATCAGAACGTGAAATGCAAGATAGTAGTGGTGGGAGACAGTCAGTGTGGGAAAACCGCGCTGCTGCATGTCTTCGCCAAAGACTGCTTCCCCGAGAATTACGTCCCTACAGTGTTTGAGAATTACACGGCCAGTTTTGAAATCGACACACAAAGAATAGAGTTGAGCCTGTGGGACACTTCGGGTTCTCCTTATTATGACAACGTCCGGCCCCTCTCTTACCCAGATTCTGATGCCGTGCTGATTTGCTTTGACATCAGTAGACCAGAGACTCTAGACAGTGTCCTAAAAAAGTGGAAAGGTGAGATCCAGGAGTTTTGCCCCAACACCAAAATGCTCATGGTTGGCTGCAAATCTGACCTTCGGACAGATGTTAGTACATTAGTAGAACTCTCAAATCACAGACAGACACCAGTGTCTTATGATCAGGGGGCAAACATGGCCAAACAGATTGGAGCTGCCACTTATATTGAATGCTCAGCATTACAGTCGGAAAATAGCGTCAGAGACATTTTTCATGTTGCCACTTTGGCATGTGTAAACAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGGGCCACAAAGCGGATTTCACATATGCCCAGCAGACCAGAACTCTCAGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGTTGCACCGTGATGTGAATCTCCCGTTATCTTTAATGAGGACAAGGAAATCTAGTGTAAAAAAACACCACAACAAAACAAAAAGGTGAAGTCTGAATGAAGTGCACAGCCAAAGTCACATATTCTGGAGGCTTAGGAGGCATTTGAAAGGATGCTCATCTTTTTGGAATCCTGTCCTTAGGTTCGGCATGTAGAACAAGTGGTGAAAAGTGAATACATTGAAGTGTTCTGAAGTGTGACTTGAAAAATATGCCAAAAAAGAGAGATTCAGATGGTCTAGAGGTAGATGAGGAGGAATGCGAGTACCTCCAAGAAGAAAAATCCCGCTCTGAATGGTGCTTGTGTTATCGTTTTCTTTGTTGTAATCTATTCATGAATCTCTACTTTGATTTAATTTTTAAATGTTTTAATCTCCTTTACAAAAAGTATATATTAATATACCGTCCTCATTGGGGAACTGGCACTGTGACCTTAGCATTTAGTTTTCTAGAGGATGTGATCTAATTTCCTCCTAGCTCATCATTAAAATGGAAATTATATCAGGACCCATGGGATATCCAGAGGAAAAGTTTGTGAGGCTTTGAAATCTTGCCTTCCTGAAGAGAGCTGAGCGAGATGGTTCTAAAGAAAGGCTTTTGCGGTCTTGCAAGATATGCAGACGGGCACTACAAAGATCGAATAGATTGAATAGAAAAATGGTGTCGATTTTTATTCAGTCTGATGGTTCTGTTCATCATTGTGATTGTCATTAAAAAGTGGTAAATTGCTCAATGTAATATTTTTGTGCGCTGTTTAGAAAAGAGGGTTGTGATTTTTTTGCCATCGTTGATGAAAATGCAAAGTCAAATAAAAGGTGTCTTGGTTTGGTGTCATAGAATGATCCAAGGGGAAAAAAATGTAGGTACTATTTTCACCTGAAGAGATAAGGAATGAAGGAATAGTAGCAGAAAGCACAGTTTGTGAGTAAGCGGTCTGGAATTAACTTACCAAAAGTACAAAGCAAAAGGCCTATTGTTTGGGAGGTGAAGCTCTAAAGCTGGCAGCATCTGATGATCTGTTGGTTTATTTCGTTTTACTTAAATGAACATGACAAGAGAGGGATCCTCTTGTCCAAGCCTTAGAGAATTTTTAGAGAGAAATTATGTAATGTCCATTCTGACACTATGCTAGCCGTTTCTAAAGAGTGATTGCTAAACCTCACTTAACCAGATTCTGCCAAGGCCCGTGTTCAATACTTGATTGCAGTTACATAAAATAATCAACATTTAAAATAGTTTACAGATATTTTTCGACCAGTTCCTTTTAGAGTTTCTTTCAGAGAAGAAACCAGATCTGACCTGTTTATTGTTGGCGCTTGTTGAAAACGAGCTTTCTTTCCAATGATAAAGCTTCATTTTTGAAGTGTTGAAGCTGTGCTCCCATTAAATTGTGGCAGGAGAGGAGATTAAGATAATTACAACACTTAGTTCTATGTCTTACAAGCACTTTGTTTTGTCTCTGCAAGAAAATACCATTCCAGCCATTTCTCATGAAATAACAGACGTTTTACCAACATAATATGCTTTGACTGATGCAGCATTATGCTTTGGGCAGTATTACAAAATAGCTGGCAAGTGCTTTCTGTATTTAAATATTGTAAAAAGAAAATAAGTTATAACTGTTATAAAGCAGAACTTTCGTTGCATTTTTTAAAATGTTGAAGTCAGTTTGTATGTTTGGTCAATGTTTCCGCAGTATTTATTAAAACATACTTTTTTTTCTTCAAATAAAAAAGTAACCATGTCTTTGTCTAAA