Transcript asmbl_63363

Sequence
Transcript Sequence for observation asmbl_63363 of TGE0006510:
CCGAGCTCGGAGCGCGCAGGTGAGCGTGCGAGTTCGAGCGGCCAGACTGCATTTTGTCGGCATTGTGTCGCTTTCTTTTTCTTTTTGAATTCCTGGTTTGCAGACAGCAATGGCAGCCCGAGTACTTGTAATTGGCAATGGAGGAAGAGAACATACACTGGCTTGGAAACTTGCACAGTCTGATCATGTTAAACAGGTGTTGGTTGCCCCAGGAAATGCAGGCACTGCCTGCTCTGAAAAGATTTCAAATGCTGCCATCTCCATCAGTGATCACAGCGCCCTTGCTCAATTCTGCAAAGATGAGGAAATTGAATTTGTAGTTGTTGGACCAGAGGCACCTCTGGCTGCTGGAATTGTTGGGAACCTGACATCTGCAGGAGTGCGATGCTTTGGCCCCACAGCAGAAGCGGCTCAGTTAGAGTCCAGCAAAAGATTTGCCAAGGAGTTTATGGATCGACATGGAATCCCAACTGCACAATGGAGAGCTTTCACCAAACCTGAAGAGGCCTGCAGCTTCATTATGAGTGCCAGCTTCCCTGCTTTGGTTGTGAAGGCCAGTGGTCTTGCAGCTGGGAAAGGGGTGATTGTTGCAAAGAGCAAAGAAGAGGCCTGCAAAGCTGTACAGGAGATCATGCAGGATAAAGCTTTTGGAGCAGCTGGAGAAACAGTTATCATTGAAGAACTTCTTGAAGGAGAAGAAGTGTCTTGTCTGTGCTTCACTGATGGAAGGACTGTGGCCCCCATGCCCCCAGCACAGGACCATAAGCGATTGCTAGAAGGAGATCACGGCCCCAACACCGGGGGAATGGGAGCCTATTGCCCAGTACCTCAGGTTTCTAAGGATTTGTTGCTAAAAATTAAAAATATCATTCTTCAGAGGACAGTGGATGGCATGCAGCAAGAGGGTACGCCATACACAGGTGTTCTCTATGCTGGTATAATGCTGACTAAGGATGGCCCAAGAGTTCTGGAGTTTAATTGCCGTTTCGGTGATCCAGAGTGCCAAGTCATCCTCCCACTTCTTAAAACTGATCTTTATGAAGTGATTCAGTCTACCTTAGATGGCCTGCTGTGTACCTCTCTGCCTGTTTGGCTTGAAAATCACACTGCTATAACTATTGTCATGGCAAGTAAAGGTTATCCAGGAGACTACACCAAGGGTGTGGAGATAACAGGGTTTTCTGAGGCTCAGGCTTTGGGACTGGAGGTGTTCCAAGCAGGTACTGCCCTAAAAGATGGCAAAGTGGTGACTAATGGTGGTAGAGTCCTTACAGTAACAGCCATCCAGGAAAATCTCATCTCAGCCCTTGAAGAAGCCAAGAAAGGACTAGCTGCTATAAAGTTTGAGGGAGCCATTTACAGAAGGGACATCGGCTATCGTGCCATAGCTTTCCTTCAGCAGCCCAGGGGCCTGACTTATAAGGAATCTGGGGTAGACATTGCAGCTGGAAATATGCTGGTCAGGAAAATTAAACATTTAGCAAAAGCCACCTCTAGACCAGGCTGTGATGTTGATCTTGGAGGTTTTGCTGGTCTTTTTGATTTGAAAGCAGCTGGTTTCAAAGATCCTCTTTTGGCCTGTGGAACAGATGGTGTTGGAACAAAACTGAAGATTGCCCAGCAGTGCAATAAACATGATACCATTGGTCAGGATTTGGTTGCAATGTGTGTAAATGATATTCTGGCACAAGGAGCAGAGCCCCTCTTCTTCCTTGATTACTTTGCCTGTGGAAAACTTGACCTCGATACAACTGAAGCAGTTGTTGCTGGAATTGCTAAAGCCTGTGGAAAAGCTGGATGTGCTCTCCTTGGTGGCGAAACAGCAGAAATGCCTGACATGTATACTCCAGGAGAGTATGACCTAGCCGGTTTTGCCGTCGGTGCCATGGAGCGGCATCAGAAACTCCCTCATCTGGAAAGAATCGCCGAAGGGGATGTTGTCATTGGAATAGCTTCATCTGGTCTTCACAGCAATGGGTTTAGCCTCGTGAGGAAAATTGTAGCGAAATCTTCCCTTCAGTACTCCTCCCCAGCACCCGATGGCTGCGGTGACCAGACATTAGGAGACTTGCTTCTAACTCCAACCAGAATCTACAGCCATTCACTCTTACCTGTATTACGTTCAGGACACGTCAAGGCCTTTGCCCACATTACTGGTGGAGGATTGCTAGAAAACATCCCCAGAGTCCTCCCTCAGAAATTTGCGGTGGATTTAGATGCCCAGACCTGGAGGATCCCCAGGATCTTCTCGTGGTTACAGCAGGAAGGACAGCTGTCTGAAGAAGAGATGGCCAGAACATTTAACTGTGGGGTTGGGGCTGCCCTCGTGGTATCAAAGGACGTGACAAAGCAGATTCTGAAGGATATTCAGCAGCACCAGGAAGAAGCTTGGGTGATTGGCAGGGTGGTGGCATGTCCTGAAGGTTCTCCTCGTGTGAAAGTCAGGCACCTAATCGAAGCCATGCAGATAAATGGATCAGTATTGGAGAATGGCACCCTGAAAAGCCATTTCACTGCCCAACCAAAAAAGGCAAGAGTGGCTGTCTTAATATCTGGAACAGGATCCAACCTCCAAGCTCTGATAGACAGCACTCGGGAGCCGAGCAGCTGTGCACACATTGTTGTCGTCGTCTCCAACAAAGCAGCGGTGGCTGGCTTAGATAAAGCAGCGAGAGCTGGAATTCCTACCAGAGTAATTAATCATAACTTATATAAAAGTCGTGTAGAATTTGACACTGCAATTGACCAAGTCCTTGAAGAGTTCTCCACAGACATAGTCTGTCTCGCAGGATTCATGAGAATTTTATCTGGCCCCTTTGTCAGAAAATGGAATGGGAAAATGCTCAACATCCACCCTTCCTTGCTCCCTTCTTTTAAGGGGTCAAATGCCCACGAGCAAGCCCTGGGTGCCGGTGTCAAAGTAACTGGGTGCACGGTGCACTTTGTAGCTGAAGAAGTAGATGCTGGACAAATTATTTTGCAAGAAGCTGTTCCTGTGAAGAGGGGTGACACTGTTGCAACTCTGTCTGAAAGAGTGAAATCAGCAGAGCATAAAATATTTCCCGCAGCCCTCCAGCTGGTGGCCAGTGGAACTGTGTGGCTTGGAGAAAATGGCAAACTCTGTTGGGTTAAGGAGAAATGAAGCTGCCTAATTCAGGAATGGAGCCAGTTTTGAAAGAAGTCTAGCTGTTTACATGGTGGCTTTTTTATCATAGACTCGTCCCAAAATAATGGCTGAAAAAGAGGACCTCACCCTTATTTCTTTGGCTGTTTTTTACATGAACAAAAATTCATTCCAAGCAAGACTGGTGCAGCATATCTAAGATATATATCTGCTTCATTGGTCTTCCAGGTTTTACCTGTTTACGACCTTGTTCAGAATCAAGCTAGTCATTCAGAACACCTTTCATTTTCAGCCAGATACTAAAATTCTTACTCTTTCTTTTTCTGACCAATATTTTTTTTTAGTTATATGTTTTCTAATCTTTGAAGAGTTAACCAACAAGTCTAATAATAAATTAA