Transcript asmbl_19692

Sequence
Transcript Sequence for observation asmbl_19692 of TGE0004081:
AGCAGGCGCGGCAAGGCCGAGTGCGCGCGATGCCTCACTTCACTGTGGTACCGGTGGACGGGCCGCGGCGCGGCGACTATGACAACCTCGAGGGGCTCAGTTGGGTGGACTACGGGGAGCGCGCCGAGCGAGAAGACTCAGACGGACACGGCAACCACAAAGAAAGCAGCCCTTTCCTTTGTCCCTTGGAGGCTTCCAGAGGAAGTGAATACTATGACAGGAACCTGGCACTGTTTGAGGAAGAGCTGGACATCCGCCCAAAGGTGTCATCTCTTCTGGGCAAACTCGTCAGCTACACCAATCTCACACAAGGCGCCAAGGAGCATGAGGAGGCTGAAAGTGGGGAGGGCACCCGCCGGAGAGCAGCCAAGGCACCTAGCATGGGCACCCTCATGGGGGTGTACCTACCCTGCCTGCAGAATATTTTTGGAGTTATCCTCTTCCTGCGGCTGACCTGGATGGTGGGAACAGCTGGTGTGCTACAAGCCCTCCTCATTGTTCTCATCTGCTGCTGCTGTACCTTGCTGACGGCCATCTCCATGAGCGCCATCGCCACCAATGGAGTGGTTCCAGCCGGGGGCTCCTATTTCATGATCTCCCGCTCGCTGGGGCCAGAATTTGGAGGTGCTGTGGGCCTATGCTTCTACCTGGGAACAACATTTGCGGCGGCCATGTACATCCTGGGGGCCATTGAGATCTTGCTGACTTACATTGCCCCGCCAGCTGCCATTTTTTACCCAACAGGCGCTCATGATACATCAAGTGCCACCTTGAACAACATGCGAGTGTATGGGACCATTTTTCTAACCTTCATGACCCTGGTGGTGTTTGTTGGTGTCAAGTATGTGAACAAATTTGCCTCACTCTTCCTGGCCTGTGTGATCATCTCCATCCTCTCCATCTATGCTGGGGGCATCAAGTCTATTTTTGATCCGCCCATATTTCCAGTCTGCATGCTGGGCAACAGGACCCTATCACGGGACCAGTTTGACATCTGTGCCAAGACGGCCATAGTGGATAATGAGACAGTGGCCACACAGCTATGGAGCCTCTTCTGCCACAGCACCAACCTTACCACTGACTCCTGCGACTCTTACTTCCTGCTCAACAATGTGACCGAGATCCCTGGCATTCCAGGTGCAGCTGCTGGCGTGCTCCAGGAGAACCTGTGGAGCACCTACCTGGAGAAGGGTGAGGTCGTGGAGAAGCACGGGCTGCCTTCCACAGACGCCCTTGGCGTGAAGGAGAGCCTGCCCCTATACGTGGTGGCTGACATTGCCACATCCTTCACTGTGCTGGTCGGCATCTTCTTCCCCTCTGTGACAGGCATTATGGCTGGCTCAAATCGCTCCGGGGACCTCCGCGACGCCCAGAAGTCCATTCCAGTGGGGACCATTCTGGCCATTGTTACAACTTCCCTTGTGTGTATCCTTTCCCAGGCCTGGGGCAGGTAGGGAGTGGGGCAGGAGGCACTTACGTGCACATAAGTTACCAGCTGGC