Transcript asmbl_19691

Sequence
Transcript Sequence for observation asmbl_19691 of TGE0004080:
AGCAGGCGCGGCAAGGCCGAGTGCGCGCGATGCCTCACTTCACTGTGGTACCGGTGGACGGGCCGCGGCGCGGCGACTATGACAACCTCGAGGGGCTCAGTTGGGTGGACTACGGGGAGCGCGCCGAGCGAGAAGACTCAGACGGACACGGCAACCACAAAGAAAGCAGCCCTTTCCTTTGTCCCTTGGAGGCTTCCAGAGGAAGTGAATACTATGACAGGAACCTGGCACTGTTTGAGGAAGAGCTGGACATCCGCCCAAAGGTGTCATCTCTTCTGGGCAAACTCGTCAGCTACACCAATCTCACACAAGGCGCCAAGGAGCATGAGGAGGCTGAAAGTGGGGAGGGCACCCGCCGGAGAGCAGCCAAGGCACCTAGCATGGGCACCCTCATGGGGGTGTACCTACCCTGCCTGCAGAATATTTTTGGAGTTATCCTCTTCCTGCGGCTGACCTGGATGGTGGGAACAGCTGGTGTGCTACAAGCCCTCCTCATTGTTCTCATCTGCTGCTGCTGTACCTTGCTGACGGCCATCTCCATGAGCGCCATCGCCACCAATGGAGTGGTTCCAGCCGGGGGCTCCTATTTCATGATCTCCCGCTCGCTGGGGCCAGAATTTGGAGGTGCTGTGGGCCTATGCTTCTACCTGGGAACAACATTTGCGGCGGCCATGTACATCCTGGGGGCCATTGAGATCTTGCTGACTTACATTGCCCCGCCAGCTGCCATTTTTTACCCAACAGGCGCTCATGATACATCAAGTGCCACCTTGAACAACATGCGAGTGTATGGGACCATTTTTCTAACCTTCATGACCCTGGTGGTGTTTGTTGGTGTCAAGTATGTGAACAAATTTGCCTCACTCTTCCTGGCCTGTGTGATCATCTCCATCCTCTCCATCTATGCTGGGGGCATCAAGTCTATTTTTGATCCGCCCATATTTCCAGTCTGCATGCTGGGCAACAGGACCCTATCACGGGACCAGTTTGACATCTGTGCCAAGACGGCCATAGTGGATAATGAGACAGTGGCCACACAGCTATGGAGCCTCTTCTGCCACAGCACCAACCTTACCACTGACTCCTGCGACTCTTACTTCCTGCTCAACAATGTGACCGAGATCCCTGGCATTCCAGGTGCAGCTGCTGGCGTGCTCCAGGAGAACCTGTGGAGCACCTACCTGGAGAAGGGTGAGGTCGTGGAGAAGCACGGGCTGCCTTCCACAGACGCCCTTGGCGTGAAGGAGAGCCTGCCCCTATACGTGGTGGCTGACATTGCCACATCCTTCACTGTGCTGGTCGGCATCTTCTTCCCCTCTGTGACAGGCATTATGGCTGGCTCAAATCGCTCCGGGGACCTCCGCGACGCCCAGAAGTCCATTCCAGTGGGGACCATTCTGGCCATTGTTACAACTTCCCTTGTGTACTTCAGCAGTGTGGTTCTCTTTGGCGCCTGCATTGAGGGTGTGGTACTCCGGGACAAGT