Transcript asmbl_19690

Sequence
Transcript Sequence for observation asmbl_19690 of TGE0004079:
AGCAGGCGCGGCAAGGCCGAGTGCGCGCGATGCCTCACTTCACTGTGGTACCGGTGGACGGGCCGCGGCGCGGCGACTATGACAACCTCGAGGGGCTCAGTTGGGTGGACTACGGGGAGCGCGCCGAGCGAGAAGACTCAGACGGACACGGCAACCACAAAGAAAGCAGCCCTTTCCTTTGTCCCTTGGAGGCTTCCAGAGGAAGTGAATACTATGACAGGAACCTGGCACTGTTTGAGGAAGAGCTGGACATCCGCCCAAAGGTGTCATCTCTTCTGGGCAAACTCGTCAGCTACACCAATCTCACACAAGGCGCCAAGGAGCATGAGGAGGCTGAAAGTGGGGAGGGCACCCGCCGGAGAGCAGCCAAGGCACCTAGCATGGGCACCCTCATGGGGGTGTACCTACCCTGCCTGCAGAATATTTTTGGAGTTATCCTCTTCCTGCGGCTGACCTGGATGGTGGGAACAGCTGGTGTGCTACAAGCCCTCCTCATTGTTCTCATCTGCTGCTGCTGTACCTTGCTGACGGCCATCTCCATGAGCGCCATCGCCACCAATGGAGTGGTTCCAGCCGGGGGCTCCTATTTCATGATCTCCCGCTCGCTGGGGCCAGAATTTGGAGGTGCTGTGGGCCTATGCTTCTACCTGGGAACAACATTTGCGGCGGCCATGTACATCCTGGGGGCCATTGAGATCTTGCTGACTTACATTGCCCCGCCAGCTGCCATTTTTTACCCAACAGGCGCTCATGATACATCAAGTGCCACCTTGAACAACATGCGAGTGTATGGGACCATTTTTCTAACCTTCATGACCCTGGTGGTGTTTGTTGGTGTCAAGTATGTGAACAAATTTGCCTCACTCTTCCTGGCCTGTGTGATCATCTCCATCCTCTCCATCTATGCTGGGGGCATCAAGTCTATTTTTGATCCGCCCATATTTCCAGTCTGCATGCTGGGCAACAGGACCCTATCACGGGACCAGTTTGACATCTGTGCCAAGACGGCCATAGTGGATAATGAGACAGTGGCCACACAGCTATGGAGCCTCTTCTGCCACAGCACCAACCTTACCACTGACTCCTGCGACTCTTACTTCCTGCTCAACAATGTGACCGAGATCCCTGGCATTCCAGAGAACCTGTGGAGCACCTACCTGGAGAAGGGTGAGGTCGTGGAGAAGCACGGGCTGCCTTCCACAGACGCCCTTGGCGTGAAGGAGAGCCTGCCCCTATACGTGGTGGCTGACATTGCCACATCCTTCACTGTGCTGGTCGGCATCTTCTTCCCCTCTGTGACAGGCATTATGGCTGGCTCAAATCGCTCCGGGGACCTCCGCGACGCCCAGAAGTCCATTCCAGTGGGGACCATTCTGGCCATTGTTACAACTTCCCTTGTGTACTTCAGCAGTGTGGTTCTCTTTGGCGCCTGCATTGAGGGTGTGGTACTCCGGGACAAGT