Transcript asmbl_19685

Sequence
Transcript Sequence for observation asmbl_19685 of TGE0004078:
CCATCTGGCCACCACAGGCCTCAGCTGCTGGTGCTGCTGAAGCTAGATGAGGATCTTCACGTGAAGTACCCACGGCTCCTCACCTTTGCGTCCCAGCTGAAGGCAGGCAAGGGCTTGACCATCGTTGGTTCTGTCATCCAGGGAAGCTTCTTGGAGAGCTATGGCGAGGCCCAGGCCGCTGAGCAGACAATCAAGAACATGATGGAGATTGAGAAAGTGAAGGGCTTCTGCCAGGTGGTGGTAGCCAGCAAGGTGCGTGAAGGGCTGGCCCACCTCATCCAGTCTTGCGGCCTAGGCGGCATGAGGCATAATTCCGTGGTGCTGGGCTGGCCCTATGGCTGGCGACAGAGTGAGGACCCACGTGCCTGGAAGACCTTTATTGACACCGTTCGTTGCACCACGGCTGCCCACCTGGCCCTGCTTGTGCCCAAGAACATCGCCTTCTACCCCAGCAACCATGAGCGCTACCTGGAGGGCCACATCGATGTGTGGTGGATTGTGCATGATGGTGGCATGCTTATGCTTTTGCCCTTCCTGCTGCGCCAGCACAAGGTTTGGAGGAAGTGCCGGATGCGCATCTTCACTGTGGCCCAGATGGATGACAACAGCATCCAGATGAAGAAGGATCTGGCCATCTTCCTGTACCATCTACGCCTTGAGGCAGAGGTAGAGGTAGTAGAGATGCACAACAGCGACATCTCTGCATATACCTATGAGCGGACACTGATGATGGAGCAGCGGTCCCAGATGCTGCGGCAGATGAGACTGACCAAGACTGAGCGGGAGCGAGAAGCCCAGCTGGTCAAGGACCGGCATTCAGCCTTGCGACTGGAAAGCCTGTACTCAGACGAGGAAGATGAGTCTGCAGCTGGGGCTGACAAGATCCAGATGACATGGACACGGGACAAGTATATGGCAGCTGAACCCTGGGACCCCAGCCATGCCCCTGACAACTTCCGAGAACTGGTCCATATTAAGCCGGACCAGTCCAATGTGCGGCGCATGCACACTGCTGTGAAGCTCAATGAAGTCATTGTCACACGCTCCCATGATGCCCGATTGGTCCTACTGAACATGCCTGGCCCACCCAAGAACAGCGAGGGCGATGAGAACTGTATCCTTTTGTGGAGATACAGGCAGTGGGGAAGTGGACAGCATGCGAGGTCACACTGGGTACCTGTAGTGGGGGGCCAGGTTATCCCAGTTCTGAATGATCGATAGGCCAAACTTCCCTGAGTGCCCCTTGGTCCTGGTGATGCCTCTTTGACCTGATGCCCTACAGACATGGAGTTCCTGGAGGTACTGACCGAGGGCCTTGAGCGGGTGCTGTTGGTGCGTGGCGGTGGCCGTGAAGTCATCACCATCTACTCTTGAGCCCAATACAGACTTGCGGCCTAGAGTGGAAGTGTTCAGTGTAACACCCCCTCCCAGCACCCACCTGCTAGCCCTGCTTTGCTTGGCCCTGCCCTGGACACAGCTTTGCTAGGTCTCCTTAGAGCCTGGTCCTGGGCCTGGCAATGGAGATGGATCCGAGGTCCTGCAGGACCCTGAGAGGTTTGGGGGCTGTCCCATCCAGCACTCCTGGAGTCCTGCCCTGGCTGGAGAAGACTGATGGGGCTGACATGGGGTTTGAAGGCAGCCAGCCCAGGAGAGCTATTTATTGAATATTTATTGTTTGGATGTCACCATCAGAGAGAAGGGAAAGGGTGACAAGGTCGGGGGTGGGGAGGTCTGCCCCAGCCCACCTGCTGGAAGACCTGGCTTAGGCTACTGTGGGCAGGGACCCCCACCAAGCTGAGCCTAATGGAGCCAGCTGAGGCCTGACTTTTTTCAATAAAACATTGTGTACTTCTGGG