Transcript asmbl_19684

Sequence
Transcript Sequence for observation asmbl_19684 of TGE0004077:
CCTTCTGATCCTGGTGTGTTCCCCACAGACAATCAAGAACATGATGGAGATTGAGAAAGTGAAGGGCTTCTGCCAGGTGGTGGTAGCCAGCAAGGTGCGTGAAGGGCTGGCCCACCTCATCCAGTCTTGCGGCCTAGGCGGCATGAGGCATAATTCCGTGGTGCTGGGCTGGCCCTATGGCTGGCGACAGAGTGAGGACCCACGTGCCTGGAAGACCTTTATTGACACCGTTCGTTGCACCACGGCTGCCCACCTGGCCCTGCTTGTGCCCAAGAACATCGCCTTCTACCCCAGCAACCATGAGCGCTACCTGGAGGGCCACATCGATGTGTGGTGGATTGTGCATGATGGTGGCATGCTTATGCTTTTGCCCTTCCTGCTGCGCCAGCACAAGGTTTGGAGGAAGTGCCGGATGCGCATCTTCACTGTGGCCCAGATGGATGACAACAGCATCCAGATGAAGAAGGATCTGGCCATCTTCCTGTACCATCTACGCCTTGAGGCAGAGGTAGAGGTAGTAGAGATGCACAACAGCGACATCTCTGCATATACCTATGAGCGGACACTGATGATGGAGCAGCGGTCCCAGATGCTGCGGCAGATGAGACTGACCAAGACTGAGCGGGAGCGAGAAGCCCAGCTGGTCAAGGACCGGCATTCAGCCTTGCGACTGGAAAGCCTGTACTCAGACGAGGAAGATGAGTCTGCAGCTGGGGCTGACAAGATCCAGATGACATGGACACGGGACAAGTATATGGCAGCTGAACCCTGGGACCCCAGCCATGCCCCTGACAACTTCCGAGAACTGGTCCATATTAAGCCGGACCAGTCCAATGTGCGGCGCATGCACACTGCTGTGAAGCTCAATGAAGTCATTGTCACACGCTCCCATGATGCCCGATTGGTCCTACTGAACATGCCTGGCCCACCCAAGAACAGCGAGGGCGATGAGAACTACATGGAGTTCCTGGAGGTACTGACCGAGGGCCTTGAGCGGGTGCTGTTGGTGCGTGGCGGTGGCCGTGAAGTCATCACCATCTACTCTTGAGCCCAATACAGACTTGCGGCCTAGAGTGGAAGTGTTCAGTGTAACACCCCCTCCCAGCACCCACCTGCTAGCCCTGCTTTGCTTGGCCCTGCCCTGGACACAGCTTTGCTAGGTCTCCTTAGAGCCTGGTCCTGGGCCTGGCAATGGAGATGGATCCGAGGTCCTGCAGGACCCTGAGAGGTTTGGGGGCTGTCCCATCCAGCACTCCTGGAGTCCTGCCCTGGCTGGAGAAGACTGATGGGGCTGACATGGGGTTTGAAGGCAGCCAGCCCAGGAGAGCTATTTATTGAATATTTATTGTTTGGATGTCACCATCAGAGAGAAGGGAAAGGGTGACAAGGTCGGGGGTGGGGAGGTCTGCCCCAGCCCACCTGCTGGAAGACCTGGCTTAGGCTACTGTGGGCAGGGACCCCCACCAAGCTGAGCCTAATGGAGCCAGCTGAGGCCTGACTTTTTTCAATAAAACATTGTGTACTTCTGGG