Transcript asmbl_19683

Sequence
Transcript Sequence for observation asmbl_19683 of TGE0004076:
TGTGGATACCCTGTCTCACATAGCCCAGTCCTCATGGCCTCCCCTCTCCCTAGCACAACAGCGACATCTCTGCATATACCTATGAGCGGACACTGATGATGGAGCAGCGGTCCCAGATGCTGCGGCAGATGAGACTGACCAAGACTGAGCGGGAGCGAGAAGCCCAGCTGGTCAAGGACCGGCATTCAGCCTTGCGACTGGAAAGCCTGTACTCAGACGAGGAAGATGAGTCTGCAGCTGGGGCTGACAAGATCCAGATGACATGGACACGGGACAAGTATATGGCAGCTGAACCCTGGGACCCCAGCCATGCCCCTGACAACTTCCGAGAACTGGTCCATATTAAGCCGGACCAGTCCAATGTGCGGCGCATGCACACTGCTGTGAAGCTCAATGAAGTCATTGTCACACGCTCCCATGATGCCCGATTGGTCCTACTGAACATGCCTGGCCCACCCAAGAACAGCGAGGGCGATGAGAACTACATGGAGTTCCTGGAGGTACTGACCGAGGGCCTTGAGCGGGTGCTGTTGGTGCGTGGCGGTGGCCGTGAAGTCATCACCATCTACTCTTGAGCCCAATACAGACTTGCGGCCTAGAGTGGAAGTGTTCAGTGTAACACCCCCTCCCAGCACCCACCTGCTAGCCCTGCTTTGCTTGGCCCTGCCCTGGACACAGCTTTGCTAGGTCTCCTTAGAGCCTGGTCCTGGGCCTGGCAATGGAGATGGATCCGAGGTCCTGCAGGACCCTGAGAGGTTTGGGGGCTGTCCCATCCAGCACTCCTGGAGTCCTGCCCTGGCTGGAGAAGACTGATGGGGCTGACATGGGGTTTGAAGGCAGCCAGCCCAGGAGAGCTATTTATTGAATATTTATTGTTTGGATGTCACCATCAGAGAGAAGGGAAAGGGTGACAAGGTCGGGGGTGGGGAGGTCTGCCCCAGCCCACCTGCTGGAAGACCTGGCTTAGGCTACTGTGGGCAGGGACCCCCACCAAGCTGAGCCTAATGGAGCCAGCTGAGGCCTGACTTTTTTCAATAAAACATTGTGTACTTCTGGG