Transcript asmbl_61928

Sequence
Transcript Sequence for observation asmbl_61928 of TGE0028300:
NNNNNNNNNNGCTGCCGCCGCTCTGCTGCAGCCGCAGCTGCAGCTCTGCAGAGCAAGGCTGGGGGCTGGGGCCGGGGCGCCCTCCCTCCCACCTTTTCCCGCCGCTATGAGCCAGGGAAGTTCGGGGGACTGGGCCCCACTCGAGCCCACCTCCGGACCCCCAGCGCCCCCCAATCCCTTCGTACATGAGTTACGTCTCTCCCGCCTCCAGAGGGTTAAGTTCTGCCTCCTGGGGGCACTGCTGGCCCCCATCCGAGTGCTTCTGGCCTTTATCGTCCTCTTTCTCCTCTGGCCCTTTGCCTGGCTGCAAGTAGCTGGTCTTACTGAGGAGCAGCTTCAGGAGCCACTTACGGGATGGAGAAAGACCGTGTGCCACAATGGGGTGCTGGGCCTCAGCCGCGTGCTCTTTTTCCTGCTGGGCTTCCTCCGGATTCGTGTTCGAGGCCAGCGCGCCTCTCGCCTTCAAGCCCCTGTCCTTGTTGCGGCCCCCCACTCTACTTTCTTTGACCCCATTGTTCTGCTTCCCTGTGACCTGCCCAAGGTCGTGTCCCGAGCTGAGAACCTTTCTGTGCCTGTCATTGGAGCCCTTCTTCGCTTCAACCAAGCCATCCTCGTATCCCGCCATGACCCAGCTTCTCGGCGCAGAGTGGTGGAGGAGGTCCGAAGGCGGGCTACCTCAGGAGGCAAGTGGCCCCAGGTACTGTTCTTTCCTGAAGGCACCTGTTCCAACAAGAAGGCTTTGCTTAAATTCAAACCAGGAGCCTTCATCGCAGGAGTCCCTGTGCAGCCTGTCCTCATCCGCTACCCCAACAGTCTGGACACCACCAGCTGGGCATGGAGGGGCCCTGGAGTACTCAAAGTCCTCTGGCTCACAGCCTCTCAGCCCTGCAGCATTGTGGATGTGGAGTTCCTCCCTGTGTACCACCCCAGCCCAGAAGAGAGCAGGGACCCCACCCTGTATGCCAACAATGTCCAGAGGGTTATGGCACAGGCCCTGGGCATTCCAGCCACTGAGTGTGAGTTTGTAGGGAGCTTGCCTGTGATTGTGGTGGGTCGGCTAAAGGTAGCATTGGAGCCACAGCTCTGGGAACTGGGAAAAGTACTTCGCAATGCTGGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGATGCCAGCGGTTTGGTGGACTTCCGAGATGTGGCCCTTGCACTGGCAGCTCTGGATGGGAGCAGGGACCTTGAGGAGCTGACTCTCCTGGCCTTTGAGGTACCAGGGGATTGGGAGTGGAGGGGACATCATAGCTGTGCTCACCCCACCCAGAAGCCTGTGTGGTGTGGCGCACTGTTATCAGTAGCTTCTAGATAGTAGGTGCTTGGTATCCACCCCAGTGCCACACTGTAAACTGCAGAGCCCCAGCGTCTCTATGTTGAGGCATAGCTGGGAACAGGAAGAGGACAGCAGTTATGAAGTTAGAATTCTCCTGCAGAAAGGACCCAGGGGCATAGGGAGGGCCTGTGCTCTGCATTCTTGGAAGAGGTGGAGCCTGTCAGGCAGACCTCCCGGGTAGTGTGGGGCAATGGCATGAGGGGGAGGGCTTGCCTGGTGTCCCTTCTCTCCCAGCTCTTCGCCGAGGAGCAAGCAGAGGGACCTGGCCGCCTGCTGTATAGAGACGGCTTCAGCACCATCCTGCACCTGCTGCTTGGGTCACCCCGCCCAGCTGCTGCGACTTTGCATGCTGAGCTGTGCCAGGCGGGATCCGACCAAGGCCTCTCCCTCTGTCAGTTCCAGGACTTCTCCCTCCGTGACCCACTCCACGGGAAGCTCTTCAGCACCTACCTGCGCCCCTCCCAGACACCAAATGCCTCATCCCCAGGCAGCCCCACTGCTCTGGCCAATGGGACTGTGCACGTGCCCAAGCAGAAGGGCGACTGAGCGCCTCCACCTCCCCAGCTCGCATCCAGCCCACAGACTCAGGGCAGCGCCAGGGGCTGACCCTGGGCCTCACGCCCTCTCTGCTCCTGCTTGATTTTTTGTTATTGTTGTTTGTTTTATTAAGTTTGTTTTATTAAGTTGATTTTCACTTTTTGTTTGATTTTTTGTAAGAAACTATTTTATATATAAATATAAATATAAATATATATCTATATCTATTTAAGAAAAA