Transcript asmbl_19682

Sequence
Transcript Sequence for observation asmbl_19682 of TGE0004075:
CCATCTGGCCACCACAGGCCTCAGCTGCTGGTGCTGCTGAAGCTAGATGAGGATCTTCACGTGAAGTACCCACGGCTCCTCACCTTTGCGTCCCAGCTGAAGGCAGGCAAGGGCTTGACCATCGTTGGTTCTGTCATCCAGGGAAGCTTCTTGGAGAGCTATGGCGAGGCCCAGGCCGCTGAGCAGACAATCAAGAACATGATGGAGATTGAGAAAGTGAAGGGCTTCTGCCAGGTGGTGGTAGCCAGCAAGGTGCGTGAAGGGCTGGCCCACCTCATCCAGTCTTGCGGCCTAGGCGGCATGAGGCATAATTCCGTGGTGCTGGGCTGGCCCTATGGCTGGCGACAGAGTGAGGACCCACGTGCCTGGAAGACCTTTATTGACACCGTTCGTTGCACCACGGCTGCCCACCTGGCCCTGCTTGTGCCCAAGAACATCGCCTTCTACCCCAGCAACCATGAGCGCTACCTGGAGGGCCACATCGATGTGTGGTGGATTGTGCATGATGGTGGCATGCTTATGCTTTTGCCCTTCCTGCTGCGCCAGCACAAGGTTTGGAGGAAGTGCCGGATGCGCATCTTCACTGTGGCCCAGATGGATGACAACAGCATCCAGATGAAGAAGGATCTGGCCATCTTCCTGTACCATCTACGCCTTGAGGCAGAGGTAGAGGTAGTAGAGATGCACAACAGCGACATCTCTGCATATACCTATGAGCGGACACTGATGATGGAGCAGCGGTCCCAGATGCTGCGGCAGATGAGACTGACCAAGACTGAGCGGGAGCGAGAAGCCCAGCTGGTCAAGGACCGGCATTCAGCCTTGCGACTGGAAAGCCTGTACTCAGACGAGGAAGATGAGTCTGCAGCTGGGGCTGACAAGATCCAGATGACATGGACACGGGACAAGTATATGGCAGCTGAACCCTGGGACCCCAGCCATGCCCCTGACAACTTCCGAGAACTGGTCCATATTAAGCCGGACCAGTCCAATGTGCGGCGCATGCACACTGCTGTGAAGCTCAATGAAGTCATTGTCACACGCTCCCATGATGCCCGATTGGTCCTACTGAACATGCCTGGCCCACCCAAGAACAGCGAGGGCGATGAGAACTACATGGAGTTCCTGGAGGTACTGACCGAGGGCCTTGAGCGGGTGCTGTTGGTGCGTGGCGGTGGCCGTGAAGTCATCACCATCTACTCTTGAGCCCAATACAGACTTGCGGCCTAGAGTGGAAGTGTTCAGTGTAACACCCCCTCCCAGCACCCACCTGCTAGCCCTGCTTTGCTTGGCCCTGCCCTGGACACAGCTTTGCTAGGTCTCCTTAGAGCCTGGTCCTGGGCCTGGCAATGGAGATGGATCCGAGGTCCTGCAGGACCCTGAGAGGTTTGGGGGCTGTCCCATCCAGCACTCCTGGAGTCCTGCCCTGGCTGGAGAAGACTGATGGGGCTGACATGGGGTTTGAAGGCAGCCAGCCCAGGAGAGCTATTTATTGAATATTTATTGTTTGGATGTCACCATCAGAGAGAAGGGAAAGGGTGACAAGGTCGGGGGTGGGGAGGTCTGCCCCAGCCCACCTGCTGGAAGACCTGGCTTAGGCTACTGTGGGCAGGGACCCCCACCAAGCTGAGCCTAATGGAGCCAGCTGAGGCCTGACTTTTTTCAATAAAACATTGTGTACTTCTGGGCCTCCTGCCGCCCAGGCTCTTTTTCCCCTGGCGCCAAGGGAAGAAGGCGGAATTGAACCCAGGCCCAGAGCTTGGCTCCCTGAGGCTGTGCCCCTTTCCAGCAATCTCTGGCCACCCCATTGGCCAGGCTGTCCCTCCCCTTGCCCCCAAGGCCCCTCCCACCCCCACTCCAGATAAGGCCAGCCCAAGACTGCTTCACTGGGCAATAGGCACTAGGGCTGGAATGGGGCCGCCCGGCTCCCCATGGCAGTGGGTGCTGCTGGTGGTGGGGCTGCTGCTCCCCCCCGCCACCCCCTTCTGGCTCCTCAATGTGCTGTTTCCCCCGCAAACCACGCCCAAGGCTGAGCTCAGTAACCACACAAGGCCCGTCATCCTCGGTAAGCCCCCGCCAGGCCCCTGACGCACCAGGCCAGATTTGGGGGAGCCTGGGTCCCAGCCCCTGGTAGTCAACCTTGCCAAGGCCCTTCTGCCCCTGCATTATCCCTGATACCTGCCTCAGTGTCCCGAGGGGCCAAAAGCTTGTCCTGCAGAGAAATGAACCCCTTTCCCCTACCACACTGTCCCTGTGTCTCTGAGTTATCTACCCCAGGTGGGTGGAGTGGGGGTGGGTGCCTGAGGCCTCGTCCAAGGCATTATAAGCTATGGTCAGCTGCAGCCACTGGACACTGGGCCAAGCCCCACCACTCCTTCCTCAGCCCCCACCCCAGCAAGGACAAGATGCACAACACAGGAGAGCGGGAGAGGCCCATCAAGGCCTGCCCCCTACTCTTAGGCTCAGCTCCCATTCCCCCATACCTATTTGTTCTTATCTTGGACTTTGACAGTAATGGAGAACCAGGCTAAGTGTTTGCTTTGTGGGGGCAGAGGTTAGTGGCCTTGGCCTCTGCGCTTAACCCTGCCCAAGGGGAGCCTGGGCTTTGTGCTGTTGGGGGGATGGGGCAGGGGAGTGTGGTCAGCAAGAAAGA