Transcript asmbl_61843

Sequence
Transcript Sequence for observation asmbl_61843 of TGE0006414:
CCGACGTCGCCTCCTGCGCTGGGCTCAGCCTCGCTTCTAATTGGCCACCTTCGGGGCCGCCCTCCTGCGCGCACCAGCCCTGGGTTCCCTCCGCGGTCCGCACTGGTAAAGCTATCCTCTTCCTTCTTGACCCCTGGCGGTTCCTCCCTCCCTTCCTTCCCTCCCGCTGCCGCCGTCGCTTCTGGCACCACTGCTCCCGGAGGAGCCTTCCGGCTGGGTGATGGGGTCTCGGGCCTCCACGTTACTGCGGGATGAAGAGCTCGAAGAGATCAAGAAGGAGACTGGCTTTTCCCACAGTCAGATCACCCGCCTCTACAGCCGGTTCACTAGCCTGGACAAAGGAGAGAACGGGACTCTCAGCCGGGAAGATTTCCAGCGGATTCCAGAACTTGCTATCAACCCATTGGGGGATCGGATCATCAATGCCTTCTTTCCAGAGGGAGAGGACCAGGTAAACTTCCGTGGATTCATGAGAACTCTGGCTCATTTTCGGCCCATTGAGGATAATGAAAAGAGTAAAGATGTGAATGGACCAGAACCACTCAACAGTCGAAGCAACAAACTACACTTTGCTTTTCGACTATATGATTTGGATAAAGACGACAAGATTTCCCGTGATGAGCTGTTACAGGTCCTACGCATGATGGTCGGAGTGAATATCTCAGATGAACAGCTGGGCAGTATTGCAGACAGGACCATCCAGGAGGCTGATCAGGATGGAGACAGTGCCATATCTTTTACAGAATTTGTTAAGGTTTTGGAGAAGGTGGACGTAGAACAGAAAATGAGCATCCGGTTTCTTCACTAAAGGACTGAGATCAAACTGTTTCGTGCTTTCTAGTATTTAAGAACTGGAACCTGAGAATCCTCCTGTCCACCAACCCCACCTCCATTCCATCATTCCCCTTCTCCCTAAGTACCAAGGCTGTTGCATGATAACTCAGATATGTTCTATCAACACAAACCTGCCTTTGGTGTATAAACAGGGCATTATAGAATGGTACACCTGGTCTATATCTGTTCAGTATCATTCACTGGTTATCTCCATTTCTAAATATTCCTAACCCTTCCCCCACCCCGGTTCTGCTACTGAATGCCTCATGTCCATCTAGTCTGAGAAAGTGAGAGAAGGAATTATGCCAAGAACTAACCAGCAAAGCTCTTTCACTGGATGTAGACTATAGCCATGCCACCGTCCCTCCAGCTAGGCTTTGGCATGCTCCTCCATCCTTTTTTGTATGTCCTTTGCTTCCTACTTCTCTTTCACCCAATACACCATTCACTTAGTCTTTGTCTCTCTGCTTTTTATTAAGCTTCAGCCCCCTCTGTTCTATTTGGCACTCCAAGCTATGCCTGTTCAATGAATTTCTGACTTGGCAGGATAGTTTGGTGGTCTGAAGGATTTTAATCTACTGTTACTCTTGAATGGTCTCTGGGATGTTGCCTTTCCAGGAGCTTTTCGATAACAACACTGCTCTCAGAAGAATGAGACCATCTCTTGGTCCCTTGCACTCTGCTGTGTCATCAAAAGGCCGTGGGCTAGAGATGTTCTTCTTGAAAGGTGGTGGCCTTGTTGAGAGATGTAGAGCCAAGTCTTTTCGGTGGCTTGCCCAGATCGCTCTACCTCTGGCTTCTGATTCTCAACATACATACCTACATGGCTACTTTTAATAGTACAGTGTTGTTTTTTCAGAAAATAGCCACATGCTGGCAGGTTGGCTTAGTTTGGGGACACCAATACCACCAGAATGGCTGCCCTGACAGTATGCTTGGGGACTTTCTCGTGGCTTTTTGAACAAGAAGGCTGGGCACCCTAAAAGCCTCACGTATTCCCACCTCTGCAGCATGGTTTATACCTCAGTGTTATGTGCCCTGGAATGTTTCTCACTTCACATTTCTAGGTAGAAAGATTAGTGTTATGGAAGTGCCTAACTATCCCAGTCCAAAAGATTTAAAGATTGTCCTCAGTGTCTTGAAGTTTTGTACAAAATTCTCTATGAATTTTACATTTGGCAAATGTTAATGCTGGAAGCCATAGTCAGCCCTTAATACAGGTCCAAAGCATTGAATGTATTGTATCATTAGCTGCCTAGTTACACTGACTTCCTAGCTCCTCTCAGACCACTGCTAATCCCTTAGAAACGAGGGGTCTGGCATTGGTAGCATAACCTGAGGTGGCATTACAGGCCTTTGCACGAGCCAGAGCAACTTCTCTGCCTAAGTCAGCTAAATGTAGACCTCATTGAATCAGGCTGTTGTCCTAATGTTGGTCATTTATGAGTCTGTTCATTCTTATATCTGCCCTTAGCTGATTTTCTGACTCATTGCTTGCTGGCTTGTTTCCTTGCTTTGGAAGGCTATCCAAGATGTATACACAATACTTTCAGAAGGGAACTGCTAAAACAAAAAACACCACAAAGGGATTGGAAAGAGGGGAACAGAGCAGTAGTCAGGCTAGATAACTTAAGTATAAATGACTGAGGAATTCTTGATGAAGTATCAGTCTGACTTTGTGATCAAATGATATAATATAGGAATTGTGTAAAGGGAAGAATAATCTGACATTGATTTGTTAGAGAAGTACTTCAAAGGCTCCTTGACTTGCATATTTAAAATTCCTAAGATTATGGCTTTTTCTTCCCTTTGGCTGTATAGCAAACTGTTTTAATCCACAGTTGTGCCTTATCGTTCCATTAAAACTGTATTCTATCCATCAATAAACACTTGTGGTTAAAACAATA