Transcript asmbl_61768

Sequence
Transcript Sequence for observation asmbl_61768 of TGE0006406:
GTCCGCTAGGAGACGGGTGACGGCCCCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTGGGTTTCTAACCTTAAGAAAATGTTTTTCTGTTTCACTATCCTGGGGACTATTTCCAGATAGTGCTAATAACCCTCAGTATGTGGAGGACATTAATCAGAGTAGCATTTCAGCAGGCAGAGAAGAATCCTATGGGGTGACATTCCCTTCTCTTGTGGAGTGGCATGAGGAAGGTGTGTGGCCCCAGTTGTGGCTCTGCCAGCATCACTGGCCCTCTAAATGAAGTCAGAGGAGCTGCCAGTGTGGTATGACAGGACAGAGGCAGCTGGTTATTCACACCACGTGCAAGGGTTTGATCTTCTGCCATTTCTATATTTGGCACCTCTGAGCCTTCAAAAGTGAACCATTCTCTTCTTTTGCATAAGTTGCCTTATTATTCAGTCACAAGAGAGGAGTGACATGGTTCTACAGATGTCGCATTCCTTCAATCTCTTGTTGAGCTTTAGCGTGTGGGCACTGCGCTTGCCTTCTAGAGGCTCCCAGTCCAATAGAGGAGAGATAGAAACAGATTTGTTTTAATGCAAAGATACTGTAATGGACATATCTACAAGGAGCTCAAGCAGCATGAAATAGGGAGGAATTGGACTTCTCTGCATCTTTGGATGAAATCAGATGTAGAAAATCCAGCTTTTTCATGAAATTCTGCTCTGCAGGGAACCTTAGTCCTAAAAACCTGTTCAAATTTCCTGTTATATTCAAGGATAGGAAAATTAATTCGAGAGAGCATCAGAGAATTTGGCTGACCTTCCCAGAATCACAGTTACTAAATGGTAGAGCCAGGATCTCAACTTGAATACCAGCATTCTTTCCTCTAAGGTTATAGGAGAATCAGTGGAATAAACTAATGGGACATGCTCTTTGTAATGGATTTGGAAAATTGTCTGCAGCTACTTCTTTTATGAATGGTGATGTACACAGAACTTAGATAAGTTGGGTGGAACAATCTGTAATCCAAATTATAAGTATATTTGTTAACAAGACGTTTTTTCTTTCTTTTTTTTTTCAGGTTTGAAGATG