Transcript asmbl_61767

Sequence
Transcript Sequence for observation asmbl_61767 of TGE0006406:
GTCCGCTAGGAGACGGGTGACGGCCCCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTTTGAAGATGCCTCATTTAAATTGGACTAATTCCAAATTGTTTCTTCTTTTTTTTTTAAATACTTATATGCTAGTATGCTTTATGTACACAAATTGAGAAGATATATTGATGTTAACATAAATACCTTTATAATTCTACTTTGGGCTCTATGTCTTCATATTTGATGCATGTGGGTAGGTAGCTGTAGCAGGTTGCTAGAAGTTTAGAGGTGGGAAGGAGGGAATTCTCATGTTCAATATCATCATCTTGGTCTAATCTGAACTCTTTAGTATTCTGCATACAAAATTGGATAAGATCATTGTGCATGTTTAGAGTTAAGCTCCAGTTTGCATACTTTGCTTAGAATTTTTGGAAATAGTTTTTAAAAGAAAATTGTCAATTATTGGAAAATCATTATAGTGGATTGAAAGAATTTTCATATAAAATTCACATTTACCTCATATTTGTGTGGCACATATGTTGCAGGCGAGAATTCTGTCAGAGAACCACCAGTACGCCAGTTGTATTGCACATATTTTGATATTTTTGCTTCACTGATTAAAATAATGGTAAACTTG