Transcript asmbl_19648

Sequence
Transcript Sequence for observation asmbl_19648 of TGE0004071:
GACGTGCTTGACAGTCCGTAGCCGGCGCCGAGTCAGCTGGTTTTGGAATTGCGCTGCGTGCCTGCGGGTTGGGGTTCTCTGGTCCCGCCGGCCCCGCCGCAGCCATGTCGTTCTTCCCGGAGCTTTACTTCAACGTGGACAATGGCTACTTGGAGGGACTGGTGCGCGGCCTAAAGGCTGGTGTGCTCAGCCAAGCCGACTACCTCAATTTGGTGCAGTGCGAGACGCTCGAGGACCTGAAGCTGCACCTGCAGAGCACTGACTACGGTAACTTCCTTGCCAATGAGGCATCACCACTGACAGTGTCAGTCATCGATGACCGGCTCAAGGAGAAGATGGTGGTAGAGTTCCGCCACATGAGGAACCATGCCTACGAGCCACTCGCCAGCTTCCTGGACTTTATTACTTACAGCTACATGATTGACAACGTGATCCTACTCATCACGGGCACGCTGCACCAGCGCTCTATCGCCGAGCTTGTGCCCAAGTGCCACCCACTAGGCAGCTTTGAGCAGATGGAGGCCGTGAACATTGCGCAGACACCTGCTGAGCTCTACAATGCTATTCTGGTGGACACACCCCTGGCGGCTTTTTTCCAGGACTGCATCTCAGAGCAGGACCTCGATGAGATGAACATTGAGATCATCCGCAATACGCTCTACAAGGCCTACCTGGAATCCTTCTACAAGTTCTGCACCCTACTGGGCGGGACCACAGCTGATGCCATGTGCCCCATCCTGGAGTTTGAAGCAGACCGCCGCGCCTTCATCATCACCATCAACTCCTTTGGCACAGAACTGTCTAAAGAGGATCGTGCAAAGCTCTTTCCACACTGTGGGCGGCTCTACCCAGAGGGCCTGGCCCAGCTGGCTCGGGCTGATGACTACGAACAAGTCAAGAACGTGGCTGACTACTACCCGGTGAGTGCCCTGGCTACAGGACAGTGGGTGAGCGTATTGGCACCTACATACCCACACCCAACAATGCCCTTATGCTCATGCTTCCCACCACTCCCCTGGGCCAGGAGTATAAGCTGCTCTTTGAAGGAGCAGGGAGCAACCCCGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTGAAACTGAACAAGTTGGCCTTCCTGAACCAGTTTCACTTTGGTGTCTTTTACGCCTTTGTGAAGCTCAAGGAGCAGGAGTGTCGCAACATTGTATGGATTGCCGAGTGCATTGCCCAGCGTCACCGCGCCAAGATCGACAACTATATCCCCATCTTCTAGTGCCCTGGCCCAAGGCTCCCCATAAGTGTGTGTGTGTCTGTGCTGTGACCGAGGCTCCAGCTCACCTGCCTGTTCTGGGGGTAGCACATTGTCTTAGTGGCTGCCCAGTTTCCCTGACACTCTGCTCTTGGGCCTGAAAAGAGGCTGAGTACCTGTTCTCCCCACCAAGGATGGATGGACCAAGGCCCCACCTCCAGATCAAGGAGGCCCCTCAGTCCTGTTTACAGCCACTGACATGTCTGAGAAGCATGTGGTCACTTTTGTGTCCTTCCCTAACCTGAGAATCACTGGGGGCAACATGAGCCTCCTCTCTCCTTTATGGGTCAACCCCAGAGACATGGCCCAGGGGAAGGATAGTGTGTGTCTTTGAGGCATGGGGGTGCATCCCCCTCCTTCAGCTCTGCCCTTCAACAATAAACTGCCCTCTCC