Transcript asmbl_19644

Sequence
Transcript Sequence for observation asmbl_19644 of TGE0004070:
ATCGCAACGGGTCCGGAATCCGTCCGGAGGCGCGAGTCGCGAGCCAGTGGCAGGAGCCATGGCGGGCGAGGAAGACCGAGGGGACGTGGAGCCGGTATCAGTGGTGACTGTGAGGGTGCAGTACCTGGAGGACACCGACCCCTTCGCATGTGCCAACTTCCCGGAGCCGCGCCGGGCCCCTACCTGCAGCCTGGACGGGGCGCTGCCTTTGGGCGCACAGATACCCGCGCTGCACCGCCTGTTGGGGGCGCCGCTCAAGCTAGAGGACTGTGCCCTGCAAGTGTCTCCCTCTGGATACTACCTGGACCCCGAGCTGTCCCTGGAAGAGCAGCGGGAGATGCTGGAGGGCTTCTATGAAGAGATCAGCAAAGGGCGGAAGCCTACACTGATTTTGCGGACCCAGCTCTCCGTGAGGGTCAATGCCATCTTAGAAAAGTTGTATGGCTCCTGTGGCCCTGAGCTCCGCCGCTCCCTCTTCTCACTAAAGCAGATCTTCCAGGAGGACAAGGACCTGGTGCCTGAATTCGTGCACTCAGAGGGACTGAGTTGCCTGATCCGCGTGGGTGCTGCTGCTGACCATAACTACCAGAGCTACATACTCCGAGGTCAGCCCCACCCCTCCCCCATGACCCTTGCCTTCAACAACAACTTATTGACCTCTTGTTGCTGTGTCCCCAGCACTAGGCCAGCTGATGCTTTTTGTGGACGGGATGCTGGGGGTGGTGGCCCATAGTGAGACCGTGCAGTGGCTGTACACACTGTGTGCCAGCTTGTCCCGTTTGGTGGTGAAGACAGCCCTGAAGCTGCTGCTGGTGTTTGTGGAATACTCTGAGAGCAACGCACCACTGTTCATCTACGCAGTCAACTCTGTGGCCAGCAACACCGGTGCTCTTCCGTGGGCCAATATGGTATCCATCCTGGAGGAGAAGAATGGCACCGACCCTGAGTTGTTGGTGTATACAGTCACCCTCATTAACAAGACACTGGCAGCGCTCCCGGACCAGGACTCCTTCTACGACGTGACAGATGCACTGGAGCAGCAGGGCATGGAGGCACTGGTCCAGCGTCACTTAGGCACCCCGGGCACTGACGTCGACCTGCGAGCGCAGCTTGTGCTCTACGAGAGTGCCCTGCGATTGGAAGATGGAGACATTGAAGAAGCTGCAGCAGGTGGGCGGCGGGAGCGCAGAAAGCCCTCTTCAGAGGAGGGCAAGAGGAGCCGCCGATCTCTAGAAAGTGGGGGCTGCCCTGTGCGCGCCACAGAGCCTGGAGCCCGGTTCCTGGAGAATGTGG