Transcript asmbl_61624

Sequence
Transcript Sequence for observation asmbl_61624 of TGE0006434:
CCTGGCCGCCCTCTCGCCGCGTCGCCGGTCCCTGAGCCGCCCGCACCTCCTCGCCTCTCCTCTCCCGGCCGAAGCCCGGGGGACCAGAGCGAGAAGCGGGGACTATGTTCCGACGCAAGCTGACGGCCCTCGACTACCACAACCCTGCCGGCTTCAACTATAAAGATGAAACAGAATTTAGAAACTTTATTGTTTGGCTTGAAGACCAGAAAATCAGACACTACAAGATTGAAGACAGAGGTAATTTAAGAAACATCCACAGCAGTGACTGGCCCAAGTTCTTTGAAAAGTATCTCAGAGATGTTAATTGTCCTTTCAAGATTCAAGATCGACAAGAAGCAATTGACTGGCTTCTTGGTTTAGCTGTTAGACTTGAATATGGAGATAATGCTGAAAAATATAAGGACTTGGTACCTGATAATACTAAAAATGCTGACAAAGCAGCTAAAAATGCAGAGCCACTGATCAATTTGGATGTAAATAATCCTGATTTTAAGGCTGGTGTCATGGCTTTGGCTAACCTTCTTCAGATTCAGCGTCATGATGATTACCTGGTGATGCTTAAGGCAATTCGCATTTTGGTCCAGGAGCGCCTGACACAGGATGCAGTTGCTAAAGCAAATCAAACAAAAGAGGGCTTGCCTGTTGCTTTAGACAAGCATATTCTTGGTTTTGACACAGGAGATGCAGTTCTTAATGAAGCTGCTCAAATTCTGCGATTGCTGCACATAGAAGAGCTCAGAGAGCTACAGACAAAAATTAATGAAGCCATAGTAGCTGTTCAGGCAATTATTGCTGATCCAAAGACAGACCACAGACTGGGGAAAGTTGGAAGATGAACATTTTAGGATGTTAGCCGCTCACCTACTTAGTACAGTTGGGAACCATGTATGCTGTGGCATGTGTTTGGGAATCAAATGTCAATTTTCAAGGAAAGGATCCCAGAAAATTGACTATGTTCTAGAGATTTATCATCATTGCTTTTTCTTTAATAAAGTTCAGGAATGTAGATTTTTTTTGACTGTGTAATATTTATGTATAATTCATCTTTTTCCTTTGTGATTAAGGTACATGCCAACCCCCAACTTTGTTTAAGAAACAATATAGATCCTCAGAAG