Transcript asmbl_19626

Sequence
Transcript Sequence for observation asmbl_19626 of TGE0004067:
AGGGGCAATGGCGCAACCCGGGAAGCTGCTCAAGGAGCAGAAATACGACCGGCAGCTGAGGTTATGGGGTGATCATGGGCAAGAGGCTTTAGAATCTGCTCATGTTTGCCTAATAAATGCAACAGCCACAGGAACTGAAATTCTTAAAAACTTGGTATTACCAGGTATTGGTTCATTTACAATTATTGATGGAAATCAGGTCAGCGGAGAAGATGCTGGAAATAATTTTTTCCTCCAAAGAAGCAGTATTGGCAAGAACCGAGCTCAAGCTGCCATGGAATTCTTACAAGAATTAAATAACGATGTCTCTGGGAGTTTTGTGGAAGAGAGTCCAGAAAACCTTCTAGACAATGATCCTTCATTTTTCTGTAGGTTTACCATTGTAGTTGCAACTCAGCTTCCTGAAAGTACATTACTACGTTTAGCAGATGTCCTCTGGAATTCCCAAATCCCTCTTTTGATCTGTAGGACATATGGACTAGTTGGTTATATGAGGATCATTATAAAAGAACATCCAGTAATAGAATCTCATCCAGATAATGCATTAGAGGACCTACGTCTGGATAAGCCATTTCCTGAACTGAGAGAACATTTCCAGTCTTATGATTTGGATCATATGGATAAAAAGGACCATAGTCACACTCCATGGATTGTGATCGTAGCTAAATATTTAGCACACTGGTATAGTGAAACAAATGGACGAATGCCTAAGACGTATAAAGAAAAAGAAGAGTTCAGAGATTTGATTAGACAAGGAATTCTAAAGAATGAAAACGGGGCTCCAGAAGATGAAGAGAATTTTGAAGAAGCTATTAAAAATGTGAACACAGCACTAAATACAACTCAGATCCCAAGGAGTATCGAAGATATTTTCAATGATGATCGCTGCACAAATATCACCAAACAGACTCCATCATTTTGGATTTTAGCTCGTGCCTTAAAGGAATTTGTGGCCAAAGAGGGTCAAGGAAATTTACCTGTCCGAGGCACAATTCCTGATATGATTGCAGATTCAGGCAAATACATAAAACTGCAAAATGTTTACCGTGAAAAAGCAAAGAAAGATGCTGCTGCTGTGGGTAATCATGTTGCAAAATTGCTGCAGTCTATAGGCCAGGCACCAGAGTCCATTTCAGAGAAAGAATTAAAATTACTCTGCAGCAATTCTGCATTTCTTCGAGTGGTAAGATGTCGATCCTTAGCTGAAGAATATGGCTTGGATACAATTAACAAGGATGAAATTACTTCCAGCATGGACAGTCCAGATAATGAGATAGTATTATACTTAATGTTACGGGCTGTGGATAGATTTCATAAACAACATGGGGTATCTAACTATCAAGTTGAAGAAGATATAGGAAAGTTGAAGTCTTGTCTCACTGGCTTCCTTCAGGAATATGGACTATCTGTAATGGTGAAAGATGATTATGTCCATGAATTTTGCCGATACGGAGCTGCTGAGCCACACACCATTGCTGCATTCTTAGGGGGAGCTGCTGCTCAAGAGGTTATCAAAATAATCACCAAACAATTTGTAATTTTTAATAATACTTACATTTATAGTGGCATGTCACAAACTTCAGCAACTTTTCAGTTGTAAAATAAGCACCCTAGACAGTGTGTTAATAATCGAAACTAATGACCTTCAGGTTGTGCTCTAATCTGTAAAATTCTGTTAAGGAATATCTGTTAAAATGTTTGCTCAATAAACGTTTTTTTCATTTGTAATAATGCTGCCTTGTTGTTTGGGGTTGGGGCGAAGGAAGCAGTCATTTTCCCCAAG