Transcript asmbl_17262

Sequence
Transcript Sequence for observation asmbl_17262 of TGE0000413:
GGCGGCGGCGGCGGCGGCAGCAGCGCGGCCCCTTTAAACGCCTGCGGCGCCCCCCGCCCCCGCCATCGCGCCTCCATTTTCCCGGCCGCCCGCGCCGAGCGCCGCGCCCGCCCCGGGCCCCTCCGCCGCCGCCGGCCCGGACATGGCCGCCAACATGTACAGGGTCGGAGACTACGTCTACTTTGAGAACTCCTCCAGCAACCCATACCTGATCCGGAGAATCGAGGAGCTCAACAAGACGGCCAATGGGAACGTGGAGGCCAAAGTGGTGTGCTTCTACCGGAGGCGGGACATCTCCAGCACCCTCATCGCCCTGGCCGACAAGCACGCAACCCTGTCAGTCTGCTATAAGGCCGGACCGGGGGCGGACAACGGCGAGGAAGGGGAAATAGAAGAGGAAATGGAGAACCCGGAAATGGTGGACCTGCCCGAGAAACTAAAGCACCAGCTGCGGCATCGGGAGCTGTTCCTCTCCCGGCAGCTGGAGTCTCTGCCCGCCACGCACATCAGGGGCAAGTGCAGCGTCACCCTGCTCAACGAGACCGAGTCGCTCAAGTCCTACCTGGAGCGGGAGGATTTCTTCTTCTATTCTCTAGTCTACGACCCACAGCAGAAGACCCTGCTGGCAGATAAAGGAGAGATTCGAGTAGGAAACCGGTACCAGGCAGACATCACCGACTTGTTAAAAGAAGGCGAGGAGGATGGCCGAGACCAGTCCAGGTTGGAGACCCAGGTGTGGGAGGCGCACAACCCACTCACAGACAAGCAGATCGACCAGTTCCTGGTGGTGGCCCGCTCTGTGGGCACCTTCGCACGGGCCCTGGACTGCAGCAGCTCCGTCCGACAGCCCAGCCTGCACATGAGCGCCGCAGCTGCCTCCCGAGACATCACCCTGTTCCACGCCATGGATACTCTCCACAAGAACATCTACGACATCTCCAAGGCCATCTCGGCGCTGGTGCCGCAGGGCGGGCCCGTGCTCTGCAGGGACGAGATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCCCTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGCATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCTGAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGCGTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGGGCCTGCGAGAGCTGTTACACCACACAGTCTTACCAGTGGTATTCTTGGGGTCCCCCTAACATGCAGTGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTTGAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGACCAAACCGCAGTAACATGAGTCCCCACGGCCTCCCAGCCCGGAGCAGCGGGAGCCCCAAGTTTGCCATGAAGACCAGGCAGGCTTTCTATCTGCACACGACGAAGCTGACGCGGATCGCCCGGCGCCTGTGCCGTGAGATCCTGCGCCCGTGGCACGCTGCGCGGCACCCCTACCTGCCCATCAACAGCGCGGCCATCAAGGCCGAGTGCACGGCGCGGCTGCCCGAAGCCTCCCAGAGCCCGCTGGTGCTGAAGCAGGCGGTACGCAAGCCGCTGGAAGCCGTGCTTCGGTATCTTGAGACCCACCCCCGCCCCCCCAAGCCTGACCCCGTGAAAAGCGTGTCCAGCGTGCTCAGCAGCCTGACGCCCGCCAAGGTGGCCCCCGTCATCAACAACGGCTCCCCCACCATCCTGGGCAAGCGCAGCTACGAGCAGCACAACGGGGTGGACGGCAACATGAAGAAGCGCCTCTTGATGCCCAGTAGGGGTCTGGCAAACCACGGACAGGCCAGGCACATGGGACCAAGCCGGAACCTCCTGCTCAACGGGAAGTCCTACCCCACCAAAGTGCGCCTGATCCGGGGGGGCTCCCTGCCCCCAGTCAAGCGGCGGCGGATGAACTGGATCGACGCCCCGGATGACGTGTTCTACATGGCCACAGAGGAGACCAGGAAGATCCGCAAGCTGCTCTCATCCTCGGAAACCAAGCGTGCTGCCCGCCGGCCCTACAAGCCCATCGCCCTGCGCCAGAGCCAGGCCCTGCCGCCGCGGCCACCGCCACCTGCGCCCGTCAACGACGAGCCCATCGTCATCGAGGACTAGGGGCCGCCCCCACCTGCGGCCGCCCCCCGCCCCTCGCCCGCCCACACGGCCCCTTCCCAGCCAGCCCGCCGCCCGCCCCTCAGTTTGGTAGTGCCCCACCTCCCGCCCTCACCTGCAGAGAAACGCGCTCCTTGGCGGACACTGGGGGAGGAGAGGAAGAAGCGCGGCTAACTTATTCCGAGAATGCCGAGGAGTTGTCGTTTTTAGCTTTGTGTTTACTTTTTGGCTGGAGCGGAGATGAGGGGCCACCCCGTGCCCCTGTGCTGCGGGGCCTTTTGCCCGGAGGCCGGGCCCTAAGGTTTTGTTGTGTTCTGTTGAAGGTGCCATTTTAAATTTTATTTTTATTACTTTTTTTGTAGATGAACTTGAGCTCTGTAACTTACACCTGGAATGTTAGGATCGTGCGGCCGCGGCCGGCCGAGCTGCCTGGCGGGGTTGGCCCTTGTCTTTTCAAGTAATTTTCATATT