Transcript asmbl_19619

Sequence
Transcript Sequence for observation asmbl_19619 of TGE0004064:
GGCCTGGCCGCTCTAGCCTCGACCGGGGGAAGTCACTGTCCTTACCTTCAGCCGGAGCCCGCGCTTCGGTGGATGAGCCCGCTCGCCCTCCGCTCCGTCCCGCAGCTACCCACTGCCCGCCTGCCTCCCGCTATGGCCCTGCTGCACTCCAGCCGCGTCCTGTCCGGGGTCGCCGCCGCCTTCCACCCAGGCCTGGCGGCTGCGGCTTCCGCCAGAGCCAGCTCCTGGTGGGCCCATGTGGAGATGGGGCCCCCAGATCCCATCCTGGGAGTCACAGAAGCCTATAAGAGAGACACCAACAGCAAAAAGATGAATCTGGGAGTTGGTGCCTACCGGGATGATAATGGAAAGCCTTATGTGCTCCCTAGTATCCGGAAGGCAGAGGCCCAGATTGCTGCAAAAAATTTGGACAAAGAATACCTGCCCATTGGAGGACTTGCTGAATTTTGTAAGGCATCTGCAGAGCTAGCCCTGGGTGAGAACAGTGAAGTACTGAAAAGTGGCCGGTATGTCACCCTGCAGACCATTTCTGGAACTGGGGCCTTAAGGATCGGAGCCAGTTTTCTGCAAAGATTTTTCAAGTTCAGCAGAGATATCTTTCTGCCGAAACCATCCTGGGGAAATCACACACCCATCTTCAGGGACGCCAGCATGCAGCTACAGGGTTATCGATACTATGACCCCAAGACGTGTGGCTTTGACTTCACAGGTGCTGTGGAGGACATTTCAAAAATTCCACAGCAAAGTGTTCTTCTTCTGCACGCCTGTGCCCACAATCCCACAGGGGTGGACCCTCGCCCCGAACAGTGGAAGGAGATAGCAGCAGTGGCAAAGAAAAACAATCTCTTTGTCTTCTTCGACATGGCCTACCAAGGCTTTGCCAGTGGTGACAGTAACAAAGATGCCTGGGCCGTACGCCACTTCATCGAACAAGGCATTAATGTTTGTCTCTGCCAATCCTATGCCAAGAACATGGGCTTATACGGTGAGCGTGTGGGAGCCTTCACTATGATCTGCAAGGATGCTGATGAAGCCAAAAGGGTAGAGTCACAGTTGAAGATCTTGATTCGCCCCATGTATTCCAACCCTCCTCTCAATGGAGCCCGAATTGCCTCCACCATTCTAAACAGCCCTGACCTCCGAAAACAATGGTTGCAAGAAGTGAAAGGCATGGCTGACCGCATCATCGGCATGCGGACTCAGCTGGTCTCCAACCTCAAGAAGGAGGGGTCCTCCCACAACTGGCAGCACATCACCGACCAGATCGGCATGTTCTGTTTTACAGGACTAAAGCCTGAACAGGTGGAGCGGCTGATCAAGGAGTTCTCCATCTACATGACAAAGGATGGCCGCATCTCTGTGGCAGGGGTCACCTCAGGCAACGTGGGCTACCTTGCCCATGCCATTCACCAGGTCACCAAGTAATTTCCCTGGTGAGACAGAACAGAGACAACCTTCCAGTCGACCTCTGCTGTTGTGAGATTCACAGAGGAAGCAGGAGGGTGGACGGTGGTGAGCGGAATCATTTCTTTCAACCACAGTACTTAAAACTCAGCGTTTGAATGCGTTTCTCAGAAAAGAATGTGTAGAGAAATAGAAGCATCTGTGGCTGGTGTGTGGAACTTTGTGGCTGTAAACCAAACCCTCCCTCATCTTTGTATCTCCAGCTTTTCCGAAAAGAGTTTACATGTACAAGAAAGTCGTAGCCAAAAAATTTTATCAATCACACCATTGCAATATTTCAGAAGCTTTAATTGAAGCACCTTATGGTGTTGGTCTGGAATGAAAATACCACTTATTAGAGGCTTTGTGAGAAGACCTAGTTCTAACATTGTCAGCCTCCTGTTTGTCCTGTAATTGAGCAACCTTATCAACAGACCACATTACAGAAACTGTGTGTTTTGAAAACCAGCACGTCTATTGCCACTGCAGCAAGTTCGGGAGCGGGGGGAGATGCAATTTCCATTTTTATTTAAGAAAAAGAAAGAAGACTCTCCTTTTTAGTTCTTGCAGGCATTTTAATGTCCCTCTGTCCTCCCTTATCACTGTTGTTCTTTTTCTCAGGCACTAAGATCTATAACTAGCCTAGATTTTTATCCCTTCTACTGCTGGATTGACCGTCAGCTCCATCCTATAGCATATACTTATTTGAAGAAAAGAACATGATTTACTGCTCACCCCGTGCCCTCCCCTTTCTCGGTAAAGAATAGCAGAGAATAAGTAACTGCACTTATTTTGCCATCCCCTTCAGTGATTGTCTCCTGCGGGATGTCGCCTCTGCCCAGTTGGACCTAGTACCTTAATTCAGTGCTGTTGAGCAGTCACTCATCTCACGTCACGAGTCGGGCGATATGAGGTAGAACCAGGAAAGAAGTTATTCTGGGATTTGGTCTTAACCTTTGTGTGCTGCCAGCTGGGCTCAGGCTTCACCCTTTGGAAAGATATCCACCATCTGCTCTAATCGTGTAGACTTACTGCAGCCTGGTTTCTCTGTTACAATAAAGTTACCGTAGACCCGA