Transcript asmbl_59500

Sequence
Transcript Sequence for observation asmbl_59500 of TGE0006300:
CAGAAATAGCAGCGGCGGCGGTTCCGCCCGCGGGCGCCGGGAGGGAAAGGCGGAGACTGGGGAACGCTGGCTCGGCGCGGGCGCGGCCCCGGCCCCGGAGGATGCTGAGCCCCTGCCCGGACCGTCCCGGAGCACATGATGGCGATACGGGAGCTCAAAGTGTGCCTTCTCGGGGACACCGGAGTTGGGAAATCGAGCATTGTGTGCCGGTTTGTCCAGGATCACTTTGACCACAACATCAGCCCGACCATTGGGGCGTCTTTTATGACCAAAACTGTGCCTTGTGGAAATGAACTTCATAAATTCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCACTCCCTGGCTCCCATGTACTATCGTGGATCTGCTGCAGCTGTCATAGTGTACGACATTACCAAACAGGACTCATTCCACACCTTGAAGAAATGGGTGAAAGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCTATTGCTGGGAACAAATGTGATCTCTCAGATATAAGGGAGGTTCCCTTGAAGGATGCAAAGGAATATGCTGAATCCATAGGTGCCATTGTGGTTGAAACAAGTGCAAAAAATGCTATTAATATCGAAGAGCTCTTTCAAGGAATCAGTCGCCAGATCCCACCCTTGGACCCCCATGAAAATGGAAACAATGGAGCAATGAAGCTTGGGAAGCAAGCTACGCAAGCCAGCCGGCGGTGCTGCTGACCAGGGGTCACGGCCCACTGTACTTGAAGAAGCCAGAGTCACCTCCCCATGCACTGCTGAAGGACCCCCTAATCTTAGTGGCCTGGCGCCTCACTTAGAGAGAAGTGAGCACACTGGCTTGGCATCATGGAAGACCCACAGGGAACGGGGCAGGAAAAGTCCCCGGAAAAGGATTTGAGAAAACTCTGGAAAAATTCACCACGTCGCCTTTTGTGCATGAAATGCACACGGGAGGGAATGGATGTTAGGTAATAAGTATAGTTGAGTTTTTGTTAAACCTTAGAATATTCTCGATTTGTACAAAAATTTTACTGGTTTATTATGTGTGTGAGATTATAAAGTGGTGTTCCACTCTGATTTCCTGTGTTCCCTAGCCAAACTCCAGTAACTTCTTCAGCGCCATTGCTTCTGTTGACTAACCAGCCTTCACTGAAAGGTTAATTTAATTTTATTTAGTTTGCCTTTCACTGGAGCATAATTGGATCATCACTCAAGCTGTGGACTTGAGCTTTTATAAAAGTGGAGAAAGATGTATTAGAAACTGTTGTCAATATCTCCGACTCTTACTTGATGAACATTTTTCCAAGTTTTGATCATTATAAACAAACAAGCCCAATCTGGCTAAAAATATTGCATTTAATTTTGGGAGTGGGAGGCCTAATTTGGAAGAGTCGTTTAAAGTCACTGTATAAGCGGTGACAGATGTAGGACGTAAATATTATTCCAGAGACCATTTGGTATGCATCACCTCCACAGCAATAAATCCCTACTCTCTTAGAGAGGTTTTAATGCACAGAGTATTATTTTACTAAGAATTTGTGATAGTGTCACGTCTAAGGGGGAAATTAACTGGAGGACATTTAAGTCTATATCATAGGGCAAACTTCTAATAGCAGTTAATAACAGGTTACTGCAAAGCCAGCCAAGGGAAGTCCCAGCACCTTAAGATTCTAGACCTCTAACAGCACAATCAGAGAAAGCATTTGAGGAGATGCCAAGCCTGGGGAGGCAGATCTTAGGGCTAATGAGGACTCCAACTTTGGGATGCCAATTAACTGGGACTAGGCTGTGATAAAACCTTCCTTTTCAGGTACCCTGTCTGCTCAATTAATTAAAGATGTCTGACTGCAAAGGCAGTAAAGGGAGAAAAGGCATGAAGAGGAAGAAAAACTATTTCTATTCTAAATTCAAATCCTATTACCATTTTAATTTTCATAAAAACCTGGAAATCAAGAAGCAGTATGAGTGTGTGTGTGTGTGGGGTCCTATTAGGTCTTATATCGGGAGGTGATTCTTAAGATTTGGAATCGTGCCTTTTGTTGGGGTTAAGGAACTGTGACAGAATGGCCTCAGAAATGGTTAATTGTGCAGCATGGTCCAGCCGGTACCTTCTTTGCCATAAATGTTCAGGGGCTGAGAAACATTTATTGAAAATTTACAGTGTTAAAACCAGCAGAGAGATCATCAGCTGATTAAAGACCTCAAACTTTGAGTAACTCATGTGAGCTGGTGCTTCATGTCTTGCCACGACTGTGCCCTCTTTGCTCTTCACATATAGTGACACCGAGTCCCAACAAAAAGAAAGAGTCCTTGAGAGACCAGGGCCAAGTTTACACTTCTCTACATGGACAGTAATCAAGAAAATAGATGGAAATCACAGATTAAGGTGTTTTTGTTTGTTGTTGTTGTTTTAACAAAAGAATACGGTGTCAATTTGATTTTCTTACTTACTGCTTTGCTCAGCTTGCAAGAGTAGTTTGACAACCTTAAAATTTGAAGGCTGGAAACACTTATATTTGGTTCAAGAGTGCCTCTGAGCTCTCCCAGACAAGTACCTCAAAAAATGTTAGCAAGTGGCATTTGGATGTCTTGGTAGAGCTTTTACAGGGGTTTTTAGGGTTATCTCCACATTGTTAACATTACTTGCTAACATGATTCTGCTTGCAGGCCAAGCAATTATCATGCCTCTACAAAGCTCAAAAATTTGGGATGAAAATTGAAATGACATTTTCCAGGTGACATGCAGGCTTATTTTGGAAGCTTTCCTCATCAAGCTGTCCCTGAGAACCTGGGTTTCTCTCTAGACAGCCTCTCAGGTTTCCTAGATAAGGTGGTATGCGTCCCAGTGGAGTTACACAGCTTTAGGCTGGATCTCTAGTGGTTCTGTCTTGTATAAAATGGCTGGTCTTATAAACATGTAGAGAACTACCCACGAATGAGCCCATGGTTTTATTTCAGAAGCACATGAGGGTGTGAAACCACTCTTTTACCTTTCTGTATTGCTTTAACTATTCAAGCCAGTCAGATGACAGTGTATATAATTATTACTACTTGGAGCAACTGGTGAAAAGAGTAGATGGAACTTGGGCACACAAGCCTTCACTTAAACATGGGGTCTTCTCTGAAGACAGATGCTTCAGCCTTGTCCAGGCTTTCTTATCTTTCTTTATTCTGCCTTGAGATTACTTTCTGTTTGTTCTAACAATTGAAGTATAACCAAGTAATACTATGTAATGGCCTGGATATTACTTTTGCTCCAAAATGTCAAGTTGTTTCATGTGATGTAGCATCCTTCACATAATTTCACCAAATTTGCTCCTTTCCCTCTGTTTTCCCCCCCTTTCATGTGCAGTATATGTATATGTGTAAATATGATTTCATATTTGTTATGCCAACATATAATCCGTTTCACTGGCTAAGTTTGGCTCATGACCGTGTGTTATATAATATAGACATGGGTTCTTATTGGGATTATTTCCCAGTGGAAAGCCCTAAGATGGCAGTGGAGTCAGACATTTTATGTAGGTACATAATTGACTTGCCATTTTATAATTGAAAATGGTACACTAGTGTGTTGAATGTGATATTACCTTGTAGCCTATAGAAGATCGAAGACTTAAAACTAACCTTTAGCCAACAAAGAGCTGTGCCCCAATGAAATTTGAATTAATTTTCTGAAGGAGGTTTGGACGACTGAAATATTTCCTCTTAAGATAAAAGAATATGGCATGTGATGGCTACATTGAGCTCCTTTTAGGGGACTCCACTTCTCATTGCTCTGCAATGCTTGTAGTGAGTTGAATAATGAGCTGGCTTATGAAAGAAAGGACTCTGAGCTGTATTCAGACCTGTTAGGTATCGAGTTTACTCTTTTAATCATTATTGTTGGAACCAGACCCAGTGATCCAATGTCAGGGCTCTGTTGTGTAAACCGCTCCTTTCTCTCGTGTTTTTATAAAGGGCTTCTGTCTGGGCTGGACCCAGTTCTCACATATAGAAGATGCCACTGTAGACAGGACCTTTCTACATTGTATTCTGTAGTAAAGCATCGCCACAACATCGCCCAATTGTATCTGTTATTTTTGGTTTAACACACACTGATTCC