Transcript asmbl_59465

Sequence
Transcript Sequence for observation asmbl_59465 of TGE0006294:
GGGGGGTCTACGGCCGCATGCCGCTACGGAGCAGCCAGGCTAAGGAAACTAACTAAAACCACGGCGTATTCGTCGGCCCCAGCCTGGCTCCCGGAAGCACACGGCGGGCTTTGCTCTAGCCTCAGCGAGAACGCCGGCCGCATCCCCCTGTCCGGAGTTGGATCCCGCCGCGCTTCCGGTGTGTTTTCCGGTCCGCCTCCCCAGGCAGGAAGTGCCGGGCGCGGCCTCTGTCGCGCCTCAGTCCATCGCTCATCGCAGTCGCTCGTCGTCTCGTGCAGGGCACCGCGGGTTCTGGTGTTGGCGACGAATTAAACAGCCACCATGTCAAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCCCAGCGTGCAACATCCAATGTGTTCGCCATGTTTGACCAGTCACAAATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAATAGAGATGGCTTCATTGACAAGGAGGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCAACGGACGCATACCTCGACGCCATGATGAATGAGGCTCCAGGGCCTATAAATTTCACCATGTTCCTCACGATGTTTGGTGAAAAGTTAAATGGCACAGATCCAGAAGATGTCATCAGAAATGCTTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATTCAGGAAGATTACCTGAGAGAGCTGCTGACGACAATGGGAGATCGGTTTACGGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGAAATTTCAATTACATTGAGTTCACGCGCATCCTTAAACATGGAGCAAAAGATAAAGATGATTGAAAGAACTTTAGCTAAAACCTTTCGATTTCTTTGTCTTACTCTGTTTTATTTCCCCAGCACTTTCCCCAACATTTATCGACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTTTTTTTGATGTATTTATTCTAGACCTTTCTGCCAATTAGCACTTGTATAATCAGACTACAGATGGGGATGAGGTTGTAAATTGAAAAAGATTGCGAATAAAAATCAACAAATGTGAAAGCCCAGGAAAATATATTTGGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGCTATTTTGAAATCAAAA