Transcript asmbl_59340

Sequence
Transcript Sequence for observation asmbl_59340 of TGE0000988:
TGTCTGCACTGCTGTAGTCGCTGGTAGATGCAAAGAGAAAGCAGTGGATGGGGAAAAGAAGAGCTGCGATGATGGCATTTCTTAGGACACCTTTGGATCAATCATGAAAACAACTACTGTCTGAGCAGCTGTTGATAGCAATTAATACAGACTTAGACCGTATAAGTTAACTGTAAGTATGTATTGACAGAATGCCTGCCCCTTTCCAGGTGACCTCCGAAAATGGTTCGCTATTCACTTGACCCAGAAAACCCCACTAAATCATGCAAATCAAGAGGTTCAAATCTTCGTGTTCACTTTAAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGTAAAAGTAAAAGCAGAATGTCGATTGTCTTTATTAGTAAATATACTTCAGGTCTCCGTGCAAGATGGATCAAACGTGTTTTCTTCTGATTAGAAATAGAAACATTCTG