Transcript asmbl_17245

Sequence
Transcript Sequence for observation asmbl_17245 of TGE0000412:
GAGGAGGTCATCGTGGCCCAGGTGGACCATGGCTTGGGCTCAGCATGGGTCCCCAGCCATCGGCGGGTGAACCCACCCACACTGCGCATGAAGAAGCTGAACTGGCAGAAGCTGCCATCCAACGTGGCACGTGAGCACAACTCTATGTGGGCGTCCCTGAGCAGCCCCGACGCCGAGGCTGTGGAGCCCGACTTCTCCAGCATCGAGCGACTATTCTCCTTCCCTGCAGCCAAGCCCAAGGAGCCCACCATGGTGGCCCCCCGGGCCAGGAAGGAGCCCAAGGAGATCACTTTCCTCGATGCCAAGAAGAGCCTGAACCTCAACATCTTCCTGAAGCAATTTAAGTGCTCCAACGAGGAGGTCGCTGCTATGATCCGGGCTGGAGATACCACCAAGTTTGATGTGGAGGTTCTCAAACAACTCCTTAAGCTCCTTCCCGAGAAGCACGAGATTGAAAACCTGCGGGCATTCACAGAGGAGCGAGCCAAGCTGGCCAGCGCCGACCACTTCTACCTCCTCCTGCTGGCCATTCCCTGCTACCAGCTGCGAATCGAGTGCATGCTGCTGTGTGAGGGCGCGGCCGCCGTGCTGGACATGGTGCGGCCCAAGGCCCAGCTGGTGCTGGCTGCCTGCGAAAGCCTGCTCACCAGCCGCCAGCTGCCCATCTTCTGCCAGCTGATCCTGAGAATTGGGAACTTCCTCAACTACGGCAGCCACACCGGTGACGCCGACGGCTTCAAGATCAGCACATTGCTGAAGCTCACGGAGACCAAGTCCCAGCAGAACCGCGTGACGCTGCTGCACCACGTGCTGGAGGAAGCGGAAAAGAGCCACCCCGACCTCCTGCAGCTGCCCCGGGACCTGGAACAGCCCTCGCAAGCAGCAGGGATCAACCTGGAGATCATCCGCTCAGAGGCCAGCTCCAACCTGAAGAAGCTTCTGGAGACCGAGCGGAAGGTGTCTGCCTCCGTGGCCGAGGTCCAGGAGCAGTACACCGAGCGCCTCCAGGCCAGCATCTCGGCCTTCCGGGCACTGGATGAGCTGTTTGAGGCCATCGAGCAGAAGCAACGGGAGCTGGCCGACTACCTGTGTGAGGACGCCCAGCAGCTGTCCCTGGAGGACACGTTCAGCACCATGAAGGCTTTCCGGGACCTTTTCCTCCGCGCCCTGAAGGAGAACAAGGACCGGAAGGAGCAGGCGGCGAAGGCAGAGAGGAGGAAGCAGCAGCTGGCGGAGGAGGAGGCGCGGCGGCCTCGGGGAGAGGACGGGAAGCCTGTCAGGAAGGGGCCCGGGAAGCAGGAGGAGGTGTGTGTCATCGATGCCCTGCTGGCTGACATCAGGAAGGGCTTCCAGCTGCGGAAGACAGCCCGGGGCCGCGGGGACACCGACGGGGGCAGCAAGGCAGCCTCCATGGATCCCCCAAGAGCCACAGAGCCTGTGGCCACCAGTAACCCTGCAGGAGATCCCGTGGGCAGCACGCGCTGTCCCGCCTCTGAGCCCGGCCTTGATGCTACAACAGCCAGCGAGTCCCGGGGCTGGGACCTTGTAGACGCCGTGACCCCCGGCCCTCAGCCCACCCTGGAGCAGTTGGAGGAGGGTGGTCCACGGCCCCTGGAGAGGCGTTCTTCCTGGTATGTGGATGCCAGCGATGTCCTAACCACTGAGGATCCCCAGTGCCCCCAGCCCTTGGAGGGGGCCTGGCCGGTGACTCTGGGAGATGCTCAGGCCCTGAAGCCCCTCAAGTTCTCCAGCAACCAGCCCCCTGCAGCCGGAAGTTCAAGGCAAGATGCCAAGGATCCCACGTCCTTGCTGGGCGTCCTCCAGGCCGAGGCCGACAGCACAAGTGAGGGGCTGGAGGACGCTGTCCACAGCCGTGGTGCCAGACCCCCTGCAGCAGGCCCAGGTGGGGATGAGGACGAGGACGAGGAGGACACGGCCCCAGAGTCCGCACTGGACACATCCCTGGACAAGTCCTTCTCCGAGGATGCGGTGACCGACTCCTCGGGGTCGGGCACACTCCCCAGGGCCCGGGGCCGGGCCTCAAAGGGGACCGGGAAGCGAAGGAAGAAGCGTCCCTCCAGGAGCCAGGAAGAGGTTCCCCCTGATTCTGATGATAATAAAACAAAGAAACTGTGTGTGATCCAGTAAGGCCTCAGGCCCAGGCCCAAGGCCAAGTGAGAGAGCCCAGGCCACAGGACATGCTGCCATTCTGCCAAGAGAGGCTCTTCTGGGGGCCAGGCTGGGACTGGGCCCCGGAAACCAAAACTCCGTGCCTTACCCAGCCGGGGCCCTCCTGGAGCCTTCTTGGGGTGTTGTGGCTGGGAACCCGACAGGCACCAGTGCCCTGCCAGGCCTGGTGCCCTCCTGGACCGCCTGCACGTGCCAGCCTCCCACCTGCTTCCTAAAGGCAACCCTGGCCCACACCCGCATGCGCCCGGTGCAGCCTGCCAAGGGCCAGTCGGGGGGTGCTGCGTCCTGCCAGTGTCCACCACAGCTCTGCCTGCCCTTCAGCCCAGCAAGGTTTAATCAAAATGCAATGCTTTGCAAGTCTTTACTGCTTGGAGGTGGCTGAGTTGGGGGCCCTGGGCAGGGGTAAGCTGGCAGGCAGTGCCATGGCAGGCCAGGGTCCCCTCCCATGGGGTCTGGCCCCCGTTCCAGCATGTCCAGCCCCTGAAGTTGGAGTGGGGGGCGGTCTGCCTTTGCTGCCACTGCCAGGCCTCTGCCCTGCAGCTGAAACTTGGCCATCACATCAACAGAAAACCCCTCCCAGTGCCAGCTGCCCAGCGTGGGCAGGCCCTGGGGACAATACAGGTCCACCTGAGGGGCTGCAGGGTGACACCCAGCAGCCGCTGCCCCCTCACTGCCCACCCAGCGAGGGCAGCCTACCCGAGCCTGCCCCCTGCCAGGTGTGTGCCCTGAGGCTGGCGGCTGGATGCGTGGCCAATAAAAAGCAGACCTAGCCCGGTGTGCGACTGTCGTGTTCAGAGGCTGCGGGAGTGGG