Transcript asmbl_59001

Sequence
Transcript Sequence for observation asmbl_59001 of TGE0001954:
TCTCAGTTCTGCGGCAGTGTGAGTGGATAGAGTGGCGGTGCACTCGTGTTGGCTCTCAAAATCCCCGCGTAGCCACTGTCGCCTTTTCCAGCCCTCGCCATGTTCCTCACCCGGTCTGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATCGAGGCTATCAAGCTTGGTTCTACAGCTATTGGAATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACCTCCCCACTCATGGAGCCAAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGACGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACATACAATGAGACAATGACAGTGGAGAGTGTGACCCAGGCTGTGTCCAATCTCGCTCTGCAGTTTGGAGAAGAAGATGCAGACCCGGGTGCCATGTCTCGTCCGTTTGGAGTAGCACTGTTATTTGGAGGAGTTGATGAGAAAGGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCTTTGCAAGAAGTTTACCACAAGTCTATGACACTGAAAGAAGCCATCAAATCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACTAACATAGAGCTAGCCACTGTGCAGCCCGGCCAGAATTTCCACATGTTCACAAAGGAGGAGCTCGAAGAGGTTATCAAGGACATTTAAGGAAGCGTGATCCTCAGAGCTTCTCTGGGACAGTTTCAGTTCTCCTAATTGCCCTTAACTTTTATTTCCAGCTCATATTCCTTGGAAAATCTCCAGTATATGTGCATTTTTTTATGATGTCTGTACATAAAGGCAGTTCTGAAATAAAGAAAAATTTAAAGTATTTGTTAATAGACTATTCTAATGCAGTCTTTTATTCAAACTGCTTATGTTAGGGAGCAAGAAAGATAGTGGTATTCATATCCCTGCCCTCTCAGAGTATCTATTCTGAAATAATTTTAGTGGCTTGCTGCAACAGAATCAACTATATCATGAGTTCCTGAGTGTTGGCAATGAACTCAAACTAATCCAGCTCCTCCCAGTGGTTTAAGATGTTAATACCATTGTAAAGCCACTTCAATCCTATAGTTAATCTTGAGTAAACAGGTATTTTTGCTGCTTTTCTTATATGAAGGAGATGCTACTAATTGACCATCAAAAGAACATGTTTTGAGGTCCTCCCCAAACCCTGATGAACAGTTAGAATACACCAGCTATGATGTTGTACCAGTTCTAGTGTCTTAACAGACAATTTGAAAAGAGATTTAAAAAAAAAATTTAGGTAAGGACAATAAAAATGGAATTCAATTACAAAACGAGTATGAGAGAATGGTATAATTCTTCAGTAGTTTATATTAAACACTTTGGAATGTACTATGAACTTCCTCCATTAGAGCTGCCATCATATAACTGGTTGAGATTAAAGAATCAGTCTATTCGAGCCTCAAAAATGGCCATATAAAGTAGATCTCATTATTGTATTTAACATGAAGAATCTAAGGCTGTGTGACTGGACAGAAAATTGAGTTGTTAGGAACCAAACTCAGATTTTCTGGTTTCAAATCATCAACTCTTTGTTTTACGACGCCAGGTCCTTTGAAGCCTAGACACCTACTGAGTAATGGGGAAATCTCATCGAGATTTGAAATGTATTTGCAACATCCACAATGTGGCTAATCAACATGTGGATAATGCAGAATTGATTGTGTATTGTCTTCATTAACATTTGTAGGAAGTTGTACTCTGTGATGTCAAAATAAATGCAGATGATTTAAGTAGGCTGAATTTATATTAAACTCACCATATTTCCAGCATAAAACAGCTTGTGCTTATTATATACATTTGGAAACTCCTATGATGGGAAATATTTAGAAGAATTTTGCCCTAGACATACACATAAGGAAAGTATGAGAACTTTATTGTCACTTATGTTCTGGAG