Transcript asmbl_58008

Sequence
Transcript Sequence for observation asmbl_58008 of TGE0028177:
GTGTGTGTGTGTGTGTGTGTGAATGTGCTTGTCTCCCACAGATTCCTGGATTTCTGTAAAGAAAATGGGGGGTATACTGGGTGCCCCTTCCCTGCCAAACTGGACCTGCAGCAAGGACAGAACTTACTCCAAGGTCTGAGTAAGCTCAGCTCCTCTACCTCAGGGCCCCGAAGTCGCGACTACCTCCCCCAGGAGCGAGGGCGCGAAGGCGGCCTGCACCTGCAAGTGGAGCCAGAGTGGAGGAACGAGCTCTGAAGAGATGGCGGCTGGCCTCGCGCGCCAGTCAAGCCTTCCGTGCCCGGCCACCCGGCCACCCGCCCTGACCCAGAACCCAGCCGAGCTGCCCCTCCCAGGGACAGGAAGGCTGGGAGTTTACATCCCCTCCCCTGCTGG