Transcript asmbl_57993

Sequence
Transcript Sequence for observation asmbl_57993 of TGE0006217:
CGACCATCTTGCTCCTGCCCCTGACAGACTCTGTTCCAGGTCAGTGGGACGCTAAGACCGCCGAGTGACCCCTCGCTGACCATGTTGTCCCGGGTGGTACTTTCTGCCGCCGCCACAGCAGCCCCCTCTCTGAAAAACGCAGCCCTCCTCGGTCCAGGAGTATTGCAGGCAACAAGGATCTTTCACACTGGGCAGCCGAGTCTTGCCCCTGTACCACCTCTTCCTGAATATGGAGGGAAAGTTCGTCATGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCCAAAACCGGTGTAACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTTCTGTCCAAAGAAATATATGTGGTTACCCCAGAGACCATCTCTGCCATATCAACAATAGGGTTGCTTGTCTATGTAATTAAAAAATATGGTGCCTCTATTGGGGAATTTGCTGATAAACTCAATGAGCAAAAAATTGCCCAACTAGAAGAAGTGAAGCAGGCTTCCATCAAATACATCCAGGATGCAATTGATACGGAGAAGTCACAGCAGGCACTGGTTCAAAAACGTCATTACCTTTTTGATGTCCAGAGGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACAAGGAGGTAAAGAGTCGCCTGGACTACCATATCTCTGTGCAGAATATGATGCGTCGAAAGGAGCAAGAACACATGATAAACTGGGTGGAGAAGCACGTGGTACAGAGCATCTCTGCACAGCAGGAAAAGGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGCTTGCAAAGAAGGCCCAAGCACAGCCAGTTCTGTAAATGCGTCTATCCTGATCCAGACAGCTAGAAACAGTTGACTGACTAAATGGAAGCTAGCCTATGGGACAGAATCTTTCTGTACTGCGTTCTACTGAAGTTTCATTTCATCTTACCTGAAAATGAAAAGCTTGGGTTCATATAGAAAGAGAATTAAAACAATATTTTGGTCAGTGA