Transcript asmbl_1878

Sequence
Transcript Sequence for observation asmbl_1878 of TGE0004050:
GGGGCGTGCCCGGCCTTCCCCAACGCCCGGCAATCCCCGCCGTCGCCGCTGCCGCCTCGGCCCCTGCCGGGGCTTCCCGCAGCCGCCATGTCCGCCAGTGCCGTCTACGTGCTGGACCTGAAGGGCAAGGTGCTCATCTGCCGGAACTACCGCGGTGATGTGGACATGTCAGAAGTGGAACACTTCATGCCCATCCTGATGGAGAAGGAGGAGGAGGGGATGCTGTCGCCCATCCTGGCCCATGGCGGGGTCCGCTTTATGTGGATCAAGCACAACAACCTGTATCTGGTCGCCACCTCCAAGAAGAACGCGTGCGTGTCACTGGTGTTCTCCTTCCTCTATAAGGTGGTGCAGGTATTTTCAGAGTACTTCAAGGAGCTGGAGGAGGAGAGCATCCGCGACAACTTTGTCATCATCTATGAGCTGCTGGATGAGCTCATGGACTTCGGCTACCCCCAGACCACAGACAGCAAGATTCTACAGGAGTACATCACTCAGGAAGGCCACAAACTGGAAACGGGGGCCCCGCGGCCCCCAGCCACTGTCACCAACGCAGTGTCCTGGCGGTCCGAAGGCATCAAGTACCGGAAGAACGAGGTGTTCTTGGATGTCATCGAGTCAGTCAACCTCTTGGTCAGCGCCAATGGCAACGTCCTGCGCAGTGAGATTGTGGGCTCCATCAAGATGCGGGTCTTCCTCTCTGGCATGCCCGAGCTGCGCCTGGGCCTCAACGATAAGGTCCTCTTCGACAACACGGGCCGAGGCAAAAGCAAGTCAGTGGAGCTGGAGGATGTGAAGTTCCACCAGTGCGTGCGGCTGTCCCGCTTCGAGAACGACCGCACCATCTCCTTCATCCCCCCCGACGGCGAGTTCGAGCTCATGTCCTACCGTCTCAACACCCACGTCAAGCCCTTGATATGGATCGAGTCGGTGATTGAAAAGCATTCCCACAGCCGCATCGAGTACATGATCAAGGCCAAGAGCCAGTTCAAGCGGCGGTCAACGGCCAACAACGTGGAGATCCACATCCCTGTGCCCAATGACGCCGACTCGCCCAAGTTCAAGACAACAGTGGGGAGCGTCAAGTGGGTCCCTGAAAACAGCGAGATCGTGTGGTCCATCAAGTCTTTCCCGGGCGGCAAGGAGTACCTGATGCGGGCCCACTTTGGCCTGCCCAGCGTGGAGGCTGAGGACAAGGAGGGCAAGCCCCCTATCAGCGTCAAATTCGAGATCCCCTACTTCACTACCTCTGGCATTCAGGTACGCTACCTGAAGATCATCGAGAAGAGTGGCTACCAGGCCCTGCCCTGGGTCCGTTACATCACTCAGAACGGAGATTACCAGCTCCGGACCCAGTGAGGGGACAG