Transcript asmbl_1877

Sequence
Transcript Sequence for observation asmbl_1877 of TGE0004048:
GGGGCGTGCCCGGCCTTCCCCAACGCCCGGCAATCCCCGCCGTCGCCGCTGCCGCCTCGGCCCCTGCCGGGGCTTCCCGCAGCCGCCATGTCCGCCAGTGCCGTCTACGTGCTGGACCTGAAGGGCAAGGTGCTCATCTGCCGGAACTACCGCGGTGATGTGGACATGTCAGAAGTGGAACACTTCATGCCCATCCTGATGGAGAAGGAGGAGGAGGGGATGCTGTCGCCCATCCTGGCCCATGGCGGGGTCCGCTTTATGTGGATCAAGCACAACAACCTGTATCTGGTCGCCACCTCCAAGAAGAACGCGTGCGTGTCACTGGTGTTCTCCTTCCTCTATAAGGTGGTGCAGGTATTTTCAGAGTACTTCAAGGAGCTGGAGGAGGAGAGCATCCGCGACAACTTTGTCATCATCTATGAGCTGCTGGATGAGCTCATGGACTTCGGCTACCCCCAGACCACAGACAGCAAGATTCTACAGGAGTACATCACTCAGGAAGGCCACAAACTGGAAACGGGGGCCCCGCGGCCCCCAGCCACTGTCACCAACGCAGTGTCCTGGCGGTCCGAAGGCATCAAGTACCGGAAGAACGAGGTGTTCTTGGATGTCATCGAGTCAGTCAACCTCTTGGTCAGCGCCAATGGCAACGTCCTGCGCAGTGAGATTGTGGGCTCCATCAAGATGCGGGTCTTCCTCTCTGGCATGCCCGAGCTGCGCCTGGGCCTCAACGATAAGGTCCTCTTCGACAACACGGGCCGAGGCAAAAGCAAGTCAGTGGAGCTGGAGGATGTGAAGTTCCACCAGTGCGTGCGGCTGTCCCGCTTCGAGAACGACCGCACCATCTCCTTCATCCCCCCCGACGGCGAGTTCGAGCTCATGTCCTACCGTCTCAACACCCACGTGAGTGCCCCAGGTGCCCCTCACCTGGGGCTGGCTGTCACCACCGGGCAGCCAGGGAGGC