Transcript asmbl_18751

Sequence
Transcript Sequence for observation asmbl_18751 of TGE0004047:
TCGCTGAACGTGGAACCCGCAGTGGGGACAGCCGAACCATGGCAGCCCTGCTGAGACCCGCCGGCTGGCTCCTGCGTGCTGGGGCGGCCCCGCGCCTCCCGCTCTCCCTGCGCCTCCTCGCTGGCGCCCCGGGCTGGCCGCACGCCGCCCTGTGTCACCCCAGCGCACGCGCTGGGCCGGTCGCCGGAGGGCCATTGAGCCAAGCCAGACTGTATGCCATTGCTGCTGAAAGAAAAAATTATCTTCAAGAGGAGTCCACCTCTCAGAGGAGGAATGCCAGTCAATTTGATTGGGCTCTGACGAGACTAGATAATTCTGTCCGAAGAACTGGCCGCATCCCAAAGACTCTTCTACAAAAAGTCTTTGATAACACCTGTGACTCGGGTTGCCCAGGTGGTAATCAAGCCTTACTTCTGCTGCGCAGCTGTGGTTCTCTCTTGCCTGAGCTAAAGGTCTCAGAGAGAACAGAATTGGCTCATAGAATATGGGACAAACTTCAGAAATTGGGTACCACGTATGATGTAAGTCACTATAATGCTTTACTTAAAGTCTACCTTCAAAATGAATATAAATTTTCACCAACTGACTTCTTGGCAAAAATGGAGGAAGCAAACATTCAACCAAACCGAGTGACTTACCAAAGGTTGATTGCCGCTTATTGTAACATGGGAGACATTGAAGGAGCCAGCAAGATTCTTGGATTTATGAAAACTAAGGATCTTCCAGTCACAGAGGCAGTATTCAGTGCCCTTGTTACAGGGCATGCAAGATCTGGAGATATGGAGAATGCAGAGAATATTCTCACCGTGATGAAAGAGGCCGGAATTGAGCCTGGTCCAGACACATACCTAGCCTTATTAAATGCATATGCTGAGAAGGGTGACATTGACCATGTTAAGCAGACTCTGGAGAAGGTGGAGAAGTCTGATCTTTACCTTATGGACCGTGATTTGTTGCAAATTATCTTTAGCTTCAGTAAAGCTGGATATCCTCAATATGTCTCAGAAATTTTGGAAAAAATTGCATATGAAAGAAGATATATTCCAGATGCAATGAACCTCATTTTGCTTTTAGTCACTGAAAAGTTGGAAGATACAGCATTGCAAGTTCTATTAGCATGTCCTATATCAAGGGAAGATGGTCTGAGTGACTTTGGCAGTTTCTTTTTACGGCACTGTGTGACTATGAATACGCCTGAAGAGAAGCTGAAAGACTACTGTAAGAAGCTAAAGGAAGCCCAGATGCACACGGCGCCTTTGCAGTTCACACTCCAGTGTGCTTTAGTAGCCAATAAAGCCGATTTGGCAAAAGCTCTAATGAAGGCTCTGAAGGAAGAAGGTTTTCCTGTCAGAACTCATTATTTCTGGCCATTGCTGGTTGGACATCAGAAGAAGAAAAATGTTCAAGGTATAGTCGAAGTCCTCAAAGGAATGCATGAAATGGGAGTAAATCCTGATCAAGAAACATACGTAAATTATGTGTTTCCATCGTTTGATAGTGTAACGTCAGTTCGTGCTATTTTGCAGGAAAATGGATGTCTACCTGAAAGTAATGTATTTTCTCAAGCTGAATTGAGAAGTGAAGCAGTAAATGGGAACTTAGACTATGTTTTGTCATTTTTGGAATCAAATACATTGCCTTTCTCACTTAGTACTTTGAGAGGCAGCCTAATTCTAGGCTTTAGGAGGTCAATGAATGTAAATCTTTGGAGCAAGATAACAGAACTGTTGTACAAGGATGGACGTTATTGCCAGGAGCCTCCAGGACCAACGGAAGCTGTTGGCTATTTTCTTTATAACTTGATTGACAGCATGAGTGACTCAGAGGTACAGGCCAAGGAGGAGCGTTTGAGACAATACTTCCATCAGCTGAAGGAGATGAATGTAAAAATTCCTGAAAATATCTACAGAGGCATTCGTAATCTACTGGATAGCTACCATGTTCCTGAATTGATTAAGGATGTTAGTATATTGGTTGAAAGAGAGAAGACAGACTCTCGAAAACTTACATCATCTGATTTGGAGTCTACTCTTGAAAAACTAAAAGCTGAAAATCAACCTATAGGAGATGTCCTAAAGCAGCTTATATTAACGCTTTGTTCAGAAGAGAACATGAAAAAAGCTCTCGAATTGAAAGCAAAATATGAACCAGACATGGCTGTTGGTGGCTATGCAGCTTTAATAAATTTGTGCTGTCGACATGATAATGCAGAAGATGCATTGAACCTGAAACAGGAATTTGACCGTTTAGACTCATCTGCTGTCCTTGACACCAACAAGTACGTAGGCCTTGTAAAAGTATTGGGAAAACATGGCAAACTCCAAGATGCTATTAACATTCTAAAGGAAATGAAAGAGAAGGATGTTCTTATCAAAGATGCAACAGTCTTGTCCTTTTTTCACATCCTAAATGGCGCAGCTTTAAGAGGTGAAACTGAAACAGTAAAACAGTTGCATGAAGCCATCGTGACTCTGGGGTTAACGAAACCATCTACTACCATAAGTTCCCCATTGGTCACTCTTTATCTGGAAAAGGATGACTTACCTGCTGCTCTTGAAGCCTCCATTGGTTGCTATGAAAAATATAAAATATTACCAAGAATTCATGATGTCCTGTGTAAACTGATAGAGAAAGGCGAGACCGATCTAATCCAGAAAGCAATGGACTTTGTGAGCCAAGAACAGGGTGAAATGACAATGCTCTATGATCTCTTCTTTGCCTTTCTACAAACAGGAAATTACAAGGAGGCCAAGAAGATCATTGAGACTCCAGGCATTAGAGCTCGACCTACAAGACTTCAGTGGTTTTGTGATAGATGTATTTCAAGTAATCAGGTTGAAACTCTAGAAAAGTTAGTGGAGCTGACACAGAAGCTATTTGAATGTGATAGAGACCAGCTGTACTACAATCTGCTAAAACTGTATAAAGTAAATGGCGACTGGCAAAGAGCTGATGCTGTCTGGAATAAAATGCAAGAAGAAAATATTATTCCTCGTGGAAAGACATTAAGATTATTAGCAGAAATCCTTAGAAACAATAATCAGGAGGTTCCGTTTGATGTACCTGAGTTGTGGAGTGAAGAAGAAAAACATTCCCTGAATTCTTCAGCTCCCTCACATGTAGAAACTAATATTGAGAAAGATCTATTGCATGCCTGCCAGTGGAAGAAAAGCAGAGATGCTTATGATACTTTCCTGAAAGCACAAAAGCAGAATGTTGTGTTTAACAGTGAAACATACAGCAGTCTTATTAAATTACTGTTGACAAAGGATAGCTTTCCACAAGCAATGCAAGTGAAAGATTTCGCTGAGACCCACATCAAGGGCTTCACACTGAACGATGCTGCCAACAGCCTCCTCATCATAACGCAAGTTAGGCGGGATTATTTGAAAGAGGCTCTAACAACGCTAAAAACGGCCTTGGATCTGAAGCAGACGCCTTCTAGGGTAGCAGTGACCCGCCTGATTCAGGCATGTGCCTTGAAGGGTGATACAGAAAGCATACATGCGATTCAGAAGATGGTAAATGGACTCAAAGATTCAATTGGACTTTCACATATGGTTTTCATCAATAACATTGCTTTGGCACAAATAAAGAACAATAACATAGATGTTGCAATAGAAAACATTGAAAATATGCTTACTTCAGGGAATCAAACTGTGGAACCCCAGTACTTTGGCTTGGCATACTTATTCAGAAAAGTAATAGAAGAGCAGTTGGAACCAGCACTTGAAAAGATAAGCATCATGGCAGAGAGATTGGCCAATCAGTTTGCAGTTTACAAACCTGTCACTGACCTTTTCCTTCAGCTTCTGGATTCAGGCAAGGTGGATGATGCCAGAGCTCTCCTACAGAGATGTGGTGCAATTGCTGAACAAACCCCAATTTTTTTGGTGTTCTGTATTAGGAGTTCTCGGAGACCAGGAAAGGCACCAACATTGAAATCTTTGTTAGAATTGATTCCTGAATTAACTGAAAAGGAAGAAGCATACAATTCCATCATGAAAAGCTATGTCATGGACAGTGATGTCCCATCTGCTAAAGCACTGTATGAAAATTTGACTGCGAAGAACATAAAATTGGATGATCTGTTTCTAAAACGTTACGCAGTTTTGCTGAAGAATGCTGGAGAGTCTGTCCCTTTTACTGAGCCTCCTGAAAGCTTTGAATTTTATGCAAAGCAGCTGAAAGAATTAAGGGAAAACCCTTTGTGAAACAAGCATGCACTACTGCTTTGTTTTGTGTGTATTTGTGATTCTGTGTCTAAAATGTTATTTTTTAAATGTATTTGAGAGGACAAAAATAAATAAATGAAAAGTTACTCTGTTTATGTACTTGTATTTATGTGTAATACAGTATATGATATGTTCAGCATCTTATTGACAATAATGTATGCATTTCGTCATCGGACTTTTTGTTTTTTGCCTACGATATAAGTCTGTGGCTCATGGTGTATGAAGCTGTAATTTTTCGGGTTTCTTCTCCTCATTGACTCTTCAGGCCCTGTACTCTATTTCATTTATTATTTTCATAGAAAGGTTGTTATTTTATTTAAGACTTGTTAATATTGTTTATCTGAAAAAATGACATCCCAGTGAGCCTTCTGATGCTTAATATTCTATACTGATATTCTGTACATGCTTGAAGCCCTGCATAATTTTCTAATTTTGTAAAATGTTGGCGCTAGAAAGCATTTACGAGTTATCACATCCAGTGCTCATCATTTTTTAGTGAGAAGCAGAGACCCAAAGAGACTGTCGCTTGCCTTGGTCAGGGTACTATTTGCCATTGCTGGATGGCTCCTCACCATGTTATTTTCCCTTCTACCACAGTGGCTTACGGGAGCCTCTTCCATAAAAGTCTCTAAAACAGTCTGAGTGATGACTTTGGTCATGAGACAGAGCAATGCATTTCCTCTCATTTTGGTTTCAGGTTTTTGTCGGCACAAGCTATAGCCTACACTGGACTTGTTACTTTATACTCATACCCTATGTGGTTAATATACAAAGGAGTAAAATCTTGGTTTTTGTTCCGTTTTGTCAAAGTTATCCCCAAATTGGCTTTCATGCCTGTTAACATCTACTTTATAAATAGTTACTATAAAAGAATTTAAGATGGTAGTCAAAACAGTTTGCCACTAGAAAGGTATCTTAATATGTAATATTGACCTAGTTGGGGATTAAGTGATTAATACAAAAGAAGTTGAAAATGTTTTATTTGAGCGTTATCCCCATTTTGGTGTATTTCTTGTCCATTTGAAATTGATGTCTCCCTACTGTTTTGGTTTCAGTTGACAATTTACTTGGTCCCTACTGTTTACATAAGGGAATGACTTTGCCTTGGGGAAGCAAGCTGACCTCGTGCTGTTCATGCTGCTAACCTGTGTCCTGTGGGACCAGCCATCCTGCATCTAGAGCCTACCGATGGCATGGGAAGGAGGGGTGATGAAGGGAAGCCAAGAAATGAATGTTGTTATAGCATTGGCCTTGCTTTTCCTCACTGGTTTTGTAGAGTTAGACCTAAGGAATTGGGATTTGGCCAGTGCCAAGTCCCAGCCAAGAGGATTTACAAAGCTTGCCTCTGTGCTCTCCTCAGGCGCAGAACCTGTACATGTTGTCTGATTTGTCACAAGCCTCCCTCCATTTGTGATTGCTCTGAAGCAGGCCTTATTTTTTGCAGTTATGCTAACCACAAGTTAAATTTTATTAGTGTTCATTAAAATAGGTTTCTAAGATGAGGCAAAACCTTGGGACATAATCTAGACTTCCCAGTCATCTTTGGGGAAACTGAGAGTACAATCTCAATTGCAGGAAGGGACTCCAAGCCAGCCTTTTATATTGACTCTGGTCAATTGTGGGTGTAGTGCGGAGGAAATAGATACAGATCCCTCATCTAGCATTCTCAACAGCAGGCTGGGGCCATTAAATAAATTACCTGTAGTAACAAAGAACTATCATGTCATATGTCTTTAGCACTGAATTGGCTTTCCCATTTGAATGAAAATATTTAAAACGTAATAATTGTATATTCTAGGTGGGCTTATGAATGGTTTCTAAATACCAGTGAAATTGAAGTAAGTAGAAACAGTAAACACATTTATAGCAACAATACATTTTAGACTCAAATTACAAACACACAGCTAATTCTAAAAATAAACAGCATTATAAACTTTTAGAAAGTATAGTGTTTTATATGTCATTGTACATCCATGTATTTGAATCTAATATAATTTTGATGTAAAATGCTCTGAATAAATTGTATACCAAAAA