Transcript asmbl_57618

Sequence
Transcript Sequence for observation asmbl_57618 of TGE0006181:
GTTTCTCGCTGCAGTCCAGCTGGGTCGAGAGGTGGCCGGGGCACACCACAGAAGGATGTTATCATCAAGTCAGATGCACCCGACACCCTATTATTGGAGAAGCATGCAGATTATATCGCATCCTATGGCTCAAAGAAAGATGATTATGTATGTATGGTTTTATGTTAAAAGCTTATTTTAAAGAAGTCAGACCATTCGGCATCATCGGTAGGTCAGTATTTATGGCCCGTGTTTTTTAATAATATCCAACTCAGTGCATGCCAAGGACTGATGATAGGTCCTTGAAATGCTGTGAAGTACACCTTTGGATATGTGAGGTTGCAGGAACATAAATATTTTAACACCGGTTCTTCCCAGTACTCTTTTAGAGGTCTTGGCAGACAGATTCCTTTCTTGTCTAGATTTGTAAGAGGTTTAAGGTGCAGAATAAGTTTCTCCTTTTGGAGTTGAGGTAAACTTTCAAGGTCAATGATGTGTTGGCATGTATTACCTGAATTTATGGCTGATGTGTAATAACACGAGCTCTAGAATTACGCTGAGACCTTGAAAAACTTACTTGGTTTCCTTTCTGGGACAATCTTAGAAAATTAGTGAATGAGTCAACTGAAAAGTATTTTTCCCTGGAGTATCCAAACAACTGGATTATATATACCATCTTGGAAAACATCGTTGATAAGTTCTTAAGTGTTTGGTTCCCATAACTTTGTAGTTACGGAGTTGTTAGGGCAATGTTTATTTTTTATCTACTGCTCACTTGATTTCTTTAAAACTGAGTTTTGGGTTCACAGCAAACCACTAAGACCACTCACTGATTCAAAACCTTAAAATATAAAGCATTGGTGACCATAGCAAAAATTTGTTTCTGGAATCTTCGTGCCAGTTTTTTTTTGATTTGTTTTAATGGCTCCATTATTAGCCACTCTTACCCATTTTATCTTTTGTATGTATTGGCCATTTTGGTTTGCAAGTAGTTAAATCATTTACTGATAAAAAGGTTTCATAAAGAGTATATGTTAAAAGAATGTCTAATAAGTACATTTCTTAAATGTTTTCCTCGAACTTGTGAAAGGTCTTTTTCTGACTTACGTTTGGCTTTTGGAAGAGATTAAAGCTGTATTTGTATTGTCAGTAAATTGAGTTTATCATGCTTTTCAAGATAGTAGTCCCCTCATGCCCCAAATTTGAAAGCCACAAGTTTAAACTTATTGATGATGGATTAAGTGAAGTAAAAAGTAACTGGCTAGCTTTCTGTGTTCAATCTCTACCCCCGCATCAATTCAAACGGCACATTAATTGTGTATTTTAGGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACTGTAATGGATCTTATGGGACAACTGCATCGCATGAATAGAGAAGAAATTCTCACATTTATTAAGTCATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATTGGACATGATCCTCATCTTCTGTACACTCTGAGTGCTGTCCAGATTCTTACTCTGTATGATAGTATTAATGTTATCGACGTAAATAAAGTTGTAGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGCTGGAGATATTTGGGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTGGCAACTTTGGCTCTATTGGGAAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGTAGGCCAGGTTCTGAATCTCATGCTGGGCAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAATCAGTTGCATCAAGTAAATTCTGATCTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGAAGGCCAGAGAAGTTACCAGATGTCTGCTATTCATGGTGGGTGTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTACGTAATTTCATCTTAGCGTGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAGATATGGTTGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACCCGTTAGTCCTGTTTTTTGCATGCCTGAGGAAGTACTTCGGAGAGTGAATGTTCAGCCTGAACTAGTGAGCTAGGTTCACTGATGCATAAGTTGCTCAATATAGTTTTGCCATCTTAACATTTCTGTATTTGAAGTGCTTACCAAACAATATGTTAATATTTTGTATATGTATTGATTTTTAATAAATTGTATAATTATACATATTGTAAAATAAAGGCCTAGTGTGTCTTCAGCTTTTCTGAGTACAATATTTGGTTTATACTTTAATGTATTTATATTCTTTGTAGCAGTAATCTTTAAGAACTATTTAGTTGAAGTCAAGTGTTATACTTGATTTTATCCTGTGCTTCCTTCATATTTTTATGTATGATAGTTCATGTAAATTGGTCTGTGTCAGTGATAATGTTAACTGATAAAAAAAATTGATAAGCCTCATTCTAAATATGAATTAAAAGATTTACAAAAACAAATGGCTGTTGAAATTTGGGAGTATTTCATAGGTTTATGGTTAACTCTGAGTTGGTCACAGTGATTTAGGTAAATGACAGTTCGTCTTAGAATATGATTACAATCGGGACTACACTTTATTCTCATTTTTAACATGTCAAAATGCCAGCTTCTTAAGCGATGGTTGGTCTTTTCCCCTTAATAAGGAGACAAGTAATAGTTGCCACAATATTTTGTGTACCCGTGTTTTCAGAAAGACTAAAATGAGCACAACTATTCTCTAAAAGTTTTTACATTCTTGGTGAAATAAAGTATTTTAATGAACATTTTTTGCGAGGTGAAAGTTGAAATTTTTCTCAAGTGTGTTTGCAATAACCTGTGTCATTTTAAGAGTAGTGTTACACAAGTAATGGTTCACTCAACATTGTTGACCAATAATACATGGTTAAACACCTTGAACGTAGGTGCTTGCATGAAATTCACTAGAGTTTTGACTAAATTGCAGTTTATGAGTTTGGAAGTCTTTGGATGAAACTTAAAATGGTGTCAGAAGTATTTGAAGTTTTGCAAAATGCAGTCATTGCTTGTGGGTGAACTATGTTGTTAAATACCTGCTTTATTGTGATAAATGCATAAATTCAATAATGTTTTAAATGAATGTCTTCTAATA