Transcript asmbl_18742

Sequence
Transcript Sequence for observation asmbl_18742 of TGE0004045:
TTTTTTTTATATATTATAGTGATCTGAATTTTAAACTTACAGGTATTGGATATGTCTCAACACCTAGTGTTTAATCCTGACCCTACTAGTTAACTAATTTTGTACTCCCATTCCCTGAAATTTAACTTGTGCCTCTTTCCCCATTGTAAGATAGGTGATGATAATACTATTTATTATAGGGTTACTGTGAAGACAAATAATAAAAACACATATAATGGATTTTAACAAATGCATGAACATATATTTTTTTTTAAAAGGAAAAGCGAGTAACTTCTATGTGCTAAAGATATCACAAACCTCAGGCTCACTTTGAGATTTCAAGAGTCAAGAGAAAATGACTGGTTGGACTTATCATTTGGCTGACCAACTGACTGAAGAGCAAATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAGGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTGGATGCTGATGGTAACGGCACAATTGACTTCCCAGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGACAAGGATGGCAATGGATATATTAGTGCAGCAGAGCTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAGATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACATTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTGTTTGTAACTTATCTGTAAAAGGTTTCCCCCTACTGTCAAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTAATTGTCATTGTCCTGAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGAAGGAGTTGGTCAAATGAGGGAACATCATCTGGGTTATGCCTTTTTTTTAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCGACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTACTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAGAAAATCTGCTTATGGCACAATTTGCCTCAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAAAATTTTACCCAATTTTACCCAACTGTTGCTCTGAATCTGAGTCATTTAATTAACTTGAGGTCAAATAATTTTGAGAATCAGATGTGGAGGTGGTTTCTACTTGGTATAATTTAGATAAGTCTTTTTTTGACTCATCAAGATTTTGTTTAGTTTTTAAATTATACTTTCTTCAGAAGGTTTAAGTGAAAGATAAAAACCTTTTGTTAAGTTGTACCTAG