Transcript asmbl_18741

Sequence
Transcript Sequence for observation asmbl_18741 of TGE0004045:
CGAGCGAGCTGAGTGGTTGTGTGGTCACGTCTCGGAGACCCGTAGCTCTTGCAGCATGGAAAAGCGAGTAACTTCTATGTGCTAAAGATATCACAAACCTCAGGCTCACTTTGAGATTTCAAGAGTCAAGAGAAAATGACTGGTTGGACTTATCATTTGGCTGACCAACTGACTGAAGAGCAAATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAGGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTGGATGCTGATGGTAACGGCACAATTGACTTCCCAGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGACAAGGATGGCAATGGATATATTAGTGCAGCAGAGCTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAGATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACATTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTGTTTGTAACTTATCTGTAAAAGGTTTCCCCCTACTGTCAAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTAATTGTCATTGTCCTGAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGAAGGAGTTGGTCAAATGAGGGAACATCATCTGGGTTATGCCTTTTTTTTAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCGACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTACTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAGAAAATCTGCTTATGGCACAATTTGCCTCAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAAAATTTTACCCAATTTTACCCAACTGTTGCTCTGAATCTGAGTCATTTAATTAACTTGAGGTCAAATAATTTTGAGAATCAGATGTGGAGGTGGTTTCTACTTGGTATAATTTAGATAAGTCTTTTTTTGACTCATCAAGATTTTGTTTAGTTTTTAAATTATACTTTCTTCAGAAGGTTTAAGTGAAAGATAAAAACCTTTTGTTAAGTTGTACCTAG