Transcript asmbl_57364

Sequence
Transcript Sequence for observation asmbl_57364 of TGE0006146:
GTGGGCCACACAAAGTCTTACTGATACCAAGTCTGGACATGTTTGAAAGGAGTGGGTCATATTCCTTGCTGTAGTTTTGTCGGAGAAGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCTCAACAAAGCAAATTATGAGCAGCTCCTTGAAGAGAATTACCTTCAGCTTATTTGGTAACCACTGCTAATAACTAAAATGCTCTTAACATGGAATAATAGACTCTGAAGTCTTTATTTTCCAACTTGTCCTTTCTCTGAAATACCCTTTACTGATTTAATACAATCCCATTTTCCATTTGGCAACTGTGGTGTCATATTGGGTTACTGATTAAGGAAAGTCAGTCCGGGCCCTTTAAAAAACTCAGTTATATACTTTTAAATATATGAATGATCCAGTTATATCAAGACCTAAATTAACTAAGCCCCTATCTAGATTAAAATGCCAAGAGTAATTTAAGTCCTTAAACCTTTATATCATAATGTGTTCTTAATAGGGTTGTGCCAACCTGTACAGTATACACGGGTGAGGAGTGTTTTGTGTATATATGTATGTCTTTGTATATACACATCTCAAAGCTTATTTCCTTATTAAAATTTCTCTCTCTCCATACCATCAGTTAAATCCACAAGTTATACCTTTATCTTAAGCTGTGTGTAGGTAGAATAAGAACTTCTTTTCATATAGTTATTGTACAAAAAGTAAAGGACATCCTAAAGGTCGTATTCATTGTAATCAAATAATGAAGTCATCTCTTGCTGACCCTCTAGTCTACAATAAACTGTGCCAATTAAAATTTTAAAACTCAGCTAAAAGCCCTTTTATAATATGATATTCATTCACCAGGGGCCTTTTCGGGCTTCAGTGATCCTGAGTCTAAAAAAAGGGGAGGACAGTGGGCAGCTGTGTCCCCAGGGCTCACATTCTCTGGATTAGGGGTTACATCTCTGAAGTTTTCACCCTAATGATGGGGATGAAACAGAGTACACAGGAGGCTGGCCGAGAGTTTTTTTTCCTGTTCTTGGCCGAACTTTATGATTTAGCTCTTTTTCTCTCTGCCTTTCCTATATCTTTCCTCTCCTGCTAGAAAATCTATTCCAGCCCCAAGTGGGTGGAACATGGTGGGAAAGAAACATACAAAATCATAAAGGTATCAAGACACAAGCTCTTTTCAAATATCTTCAGTGTCAGCCTCATCCCTACCTTGTCCCCGAACCATCCAAGAGAGGCTTGGTTTCAGTGGTACAGAATTTGGGCCCAAGGGTCCCAGGAGCTGGACATTGGGTTCCTTGATTTTCCTCTGGACACGAATGTAGCCCTCACATCCTCGGGATTTCCAGTGGGTATCCCAAAAGAAGGAATCTCCTATGACCAGAGAGTATTTTAACTTTATCAAAGAAGAAGACAGGTTATTTTTCTTAAATGCTCATTTAAGGGCCCAAAACATACACTTGGCCTATAATATTTTAATTCATCTTCAGTTCGTTAAAAATAACGACAAATGATGAAGGGTTAAAAATGTATTCTCAAAGAGGATTCAAGCCCAAGAAGGAATTATTTACAGTGGTTTTCCCTAGTTCTGTACAATCTCGCCCTGCAGTGCAAGCCCCTTTTAAAATCTAATGTCTGAGCTTTGGATAGTATGCTAATTTGAGTGAACAAATGCAGTACTATTTTTAAACTGCTCAAATATATTCAGTATTTCTCCAACTCACCTATCTATTCGGCATTGTGAACTGCCCTCATATTTCTAAGACTGGGTGAAAATCATGGCACTGCCCTTAACTTCTTGTCATCTACTGCTTGGTTCAGCAATATGCCCAATTCCCAAGTAAATTATAGTTACCTGTTTAGGAGAGAGAAAGATTTTACCTTTCAGAAGGTGAAATTTGAAATGTATGCTAAAAAGATGACTTTACCTTTAATGATTAACTTAAGGAGATATTCTTTTTTAAAATAAATATATTTTTCTGATAGTTTCAGAACACTAATCTTATTTTCACTCCGATGTTTAACATGTTTCTTTAAATATTTATAATGCATCTTGTTACAAAGTATTTTCATGAAATTATGTTTATTATATTGTTATGTGCACAGTTTTTGGTAGCAAGCATAGTACTAAAACATGTTCTTTTACCTAACAGAAAACAAATATGTTTTGCTATATATTTGTTAATATGCTTAAAGTGGTAAGGAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTTTTGCTGGCCAGGTATCCATTAAGGCCATGAATATAAATGTCGTGTAACTTCCTAACCAGGTGTGGGGCATGTTTAAGAAAAGTGAAATCAAATCCTTTGATGCTGGACCCAAGAGGGGAAAAATTGTAGTTAAATGTTGATTTACTTATAACTAGACATCTGTGTGAGAAAATATATGTATACACATATATGATATGCAGAAGTCACTATTTATCAGGCTTTATTCTACTTACAAAGCCACAGTTTGACTGTTCTGCAGCAGCTGGTTTATGACAATGGTGGACAAATGCCCAGTGCGTGTTAATTTTTCCAGCTACCATCATAATGACATAATCACGTATATATATGCAGCCATTTAAATATTTTCACTGTACTTTATCTTTAATGCTGCTTCTGTTAACAGTGATTTTTTTTTTCATTTTTATATTTTTATTAGTTCATCATAATCCTGTCCATTGAGGCCTCAGGACCATGGCAAGATATGCTATACAAAATTTCATGACTCCAAAGAATTTTACAGAACATTTTTTTTTCTATAAACACTTCATATACCAGGTGGTTCACAGGTTATAGGTAGTAACTACTTTTTTTCTAAAAAGAATCAGGTTTTTACATTTCCTTGCCCTACTGAAATAAAAAGTGCCATACTTATCTTTTAAAGGAAGGACTTGATTTGCTTTCTCTCTGGACTATTTTTGTACTTTACTAATCTAAACTATCAGAAAATACAAGTCTACCAATGATTTCGTAATTTTGAGACATAGGTTAGTTTAGGTAGAGGAGGATGTGCCAAACTTTTTCTTCAGATGCTTTCTTCTCAACCAATTTACAACTAAGATAGTGTCCTCTAAGTGATTACTCTGAATTTTGATTTAAAGTCTATATAGGCCCAAGAAGTGAATTATACTACATATCATTCTTTTCTCAATAAAATATAATACAGTATGTGTTAGGAATTGTGTTGATTTCCTTTATGGTATATCTGTTAATAGGAAAAAGTACATTGAATCAAATAGAAGTATATGTGTATTAAAACAGAGCACTTACCTAAAATTGGGCGGCCTGGATCTTAGCCCTAGATCATTTTCTAGCCAATCCTGTGTCCCTGTGTTGTGACTTTGGACAAGGCACTTGCTCTCTCTGGGCCTTCATTGCACCATCTGTAAAACAAGGGGCTTGAAGTAGATGGTGGCTGAGATCCCTTCCTGCTTTCAGATGTCTCGTTCCAATGGCCTACACCCCTACTGGTCCTGCCAACGTGTTGGTGCTATAAGCTGCTTCAAATATAAAATTGGTTTGTCTGTCATGTATGCTCATTTAATAGCTTATGAAAGGCCTTTTTGTCATACAGCTTTTTATTTCTAGTTTTACGGACTTGATTACTGTAATAATGTCTTGTTTTTAGTCATGTAACTATAAACATATACTCTCTTGATGTCTCAGTAAATTTGCATTTGATAAATATAGTTGATGGGATTTTGTTATTTTATAACATTCTTTGGCTACTCATCTGTCCAGCATCTTATTTACCTAAACACTGTGATCATTGTTTGGAAATCTGTCCTATGGAAAGAATAAAAGCATTTACTTCACAGCTAATATGTTCACAGATTTGAAAGAAGTTTCATTAAAGCACCATTACTCTCTTTACTGGGTCAGTGCCTCCTTGTGTCATCCTACCCGTGTTTTGCTCAAAAAATTAAAAGAAG