Transcript asmbl_56481

Sequence
Transcript Sequence for observation asmbl_56481 of TGE0006121:
GCTTGACGGCGAGCAGAGCCCAGCATCCGCGAGGGGCCGACGGCCAGGCTCGTCTCTCTCACGTAACTCACTCTCCTTCCACGCCGTGAGCCTAGAAAGATTGTGCGATGAATGGTGATACTCGAGCCGTCGTGGTGACCTCACCACCCCCGACCACAGCCCCTCACAAGGAGAGGTACTTCGACAGAGTGGATGAGAACAATCCAGAATACCTGCGAGAGAGGAACATGGCCCCAGACCTTCGCCAGGACTTCAACATGATGGAACAGAAAAAGAGGGTGTCCATGATTCTGCAGAGCCCCGCCTTCTGTGAAGAATTGGAATCAATGATACAGGAACAATTTAAGAAGGGGAAGAATCCCACAGGCCTGTTGGCATTACAGCAGATTGCAGATTTCATGACCGCCAATGTACCCAGCGTCTACCCGGCAGCCCCACAGGGAGGGATGGCAGCCTTGAACATGAGTCTTGGTATGGTAACTCCTGTGAATGACCTTAGAGGATCTGATTCGATTGCCTATGACAAAGGGGAGAAATTACTGAGGTGTAAATTGGCAGCGTTTTACAGACTAGCAGATCTCTTTGGATGGTCTCAGCTTATCTACAATCATATCACAACCAGAGTGAGCTCCGAGCAAGAACACTTCCTCGTTGTACCTTTTGGACTTCTCTACAGTGAAGTGACTGCATCCAGTTTGGTGAAAGTCAGTCTGCAAGGAGATATCATAGACCGTGGAAGCACTAACCTGGGAATAAATCAGGCCGGCTTCATGTTACATTCTGCCATTTATGCTGCACGACCCGACGTGAAGTGCCTTGTGCACATTCACACAGCAGCGGGGGCTGCGGTCTCGGCGATGAAATGCGGCCTCTTGCCCATCTCTCCGGAGGCGCTTTCCCTTGGAGAAGTGGCTTACCATGATTATCATGGCATTCTGATTGACGAGAAGGAAAAAGTTTTAATTCAGAAAAATTTGGGGCCTAAAAGCAAGGTCCTTATTCTCCGGAACCATGGGCTCGTGTCTGTCGGAGAGAGCGTCGAGGAGGCCTTCTACTACATCCATAACCTCGTGGTTGCATGTGAGATCCAGGTTCGAACTCTGGCCAGCACAGGAGGGCCAGACAACTTAGTCCTCCTGGATCCTGGGAAGTACAAAGCCAAGTCCCGTTCCCCGGAGTCCCCGGCAGGGGAGGGCACCGGATCACCTCCCAAGTGGCTGATTGGTGAGCAGGAGTTTGAAGCCCTCATGCGGATGCTTGATAATCTGGGTTACAGGACTGGCTACCCTTACCGATACCCGGCTCTGAGAGAGAAGTCTAAAAAATGCAGCGACGCCGAGGTCCCTGCTGGTGTCGCAGGTCACTCCTTTGCTAGTGACGGCGATTCAGGCACTTGCTCCCCTCTCAGACACAGTTTTCAGAAGCAGCAACGCGAGAAGACAAGATGGCTGAACTCTGGCCGGGGCGACGATGCCTCTGAGGAAGGGCAGAATGGAAGCAGCCCCAAGTCGAAGACTAAGTGGACTAAAGAGGATGGACATAGAGCTTCCACCTCTGCTGTCCCTAACCTGTTTGTCCCATTGAACACGAACCCGAGAGAGGTCCAGGAGATGAGGAACAAGATCCGAGAGCAGAACTTGCAGGACATTAAGACGGCCGGGCCCCAGTCCCAGGTTTTGTGTGGTGTAGTGATGGACAGGAGCCTCGTCCAGGGGGAGCTGGTGACAGCCTCCAAGGCCATTATCGAGAAGGAGTACCAGCCCCACGTCATCGTGAGTACCGCAGGCCCCAACCCCTTCACCGCGCTGACGGACCGGGAGCTGGAGGAATACCGCAGGGAGGTGGAGCAGAAGCAGAGGGGCCCCGGAGAGAGTCTGGACGAGACGACGGAGCAGAGAGACGGCAGTCCGCCGGAGCCCCCTGCCGCTCCGCACACTCCCCCCAGCACCCCTGTTAAGCTGGAGGAAGACCTGCCGCAGGAGCCCGCTTCCGGAGACGACAGTGATGCCGCCACTTTCAAGCCAACTCTCCCCGACCTGTCCCCTGATGAGCCTTCAGAAGCGCTTGGCTTCCCAGCCCTGGAGAAGGAGGAGGAAGAGGGGCTTTGTGAAGCCCGTGGCCCTCCCGGCCCCACCAGGCCCCCCGCGGCGGCTAGCCCCGAGCCGGTCGCAGCCCAGGCGGCTGAAGAGGCTGCCTCCCCAGCGGCCGAGGACGGGGCTGCCGTGGATCCTGGCAGCGATGGGTCTCCAGGCAAGTCCCCGTCCAAGAAGAAGAAGAAGTTCCGCACCCCCTCCTTCCTGAAGAAGAGCAAGAAGAGGGGCGACTCCTGAAGGCCCGTCCCGCGCAGACCCATGCCACCGGACCGTCCCCGCCTGTGCCCCCCGCTGTCTTCTCGTGTAATGGAATGCAAAAAGCCCACCCCTCCGCATAGCTAGAGCCCCTTCCCGCCATGGCCAACGCCCACGCAGATGGGTGCTGACCTGCCCCCGGCCCTCAGCCTCAGGTCCCAGGGAGACCCAGCCCACGTCCACCTCCGTACTGTCTCACTGTTCCTCGGTGACGTGCTCTTGAGAGGCGTTCAGCCACGGTTCTGGCCAGACTGTCAGAGGCTCTGTGGTCTGGCCTTGACCCCTCTTGCTCTCCTGTCGTGCAGTGACCCATGCTGTCTGCTAGGCTCCCCTTCACCCCAAGGTCTCAGGTGACTGCTGAATCAGATGTGTAGCTTCCTGCCGGCGCTGTCTGCCCAGTGATCTCTCTTGGTTCACACACACAAGGCCTCAGTCCTGTGAAAACACCGTGTGCCTGCCAGCGGCCCAGGGCACCGTGGCGGCCTTTGGGAGGCGGGTCTGGGCCGAGCTGGAAACCCCAGCAGCGGACGGGCCTGTGTGCAGCCAATGCCACCTATGCATGGTCTAACCGGTTACCCCGCAGCCAGGAACGATTCAGGGCTCACAGCTCCTCACTCACTGGGGTCCTCAGGAAGGGAAGAGTCTTTTCTAGAATTTTCTTTCAGCACATGTGCGGTTCACCCCACACTTCTGTGAATACGAATGGCCACTTTTTGCTTTCGTTCTCTCTGGGGCCTGCTGCAGAGCAGCGGTCACCTGTTGTGGGGGAGGTTTCAGAACTGAGAGGGCTCTACTCCTACTGTAACTCAGCCCGAGCGACACCGTGGCTGCGGTCCAGGGCGGCTCAAGGCAGAAGTCGGCCCTAGGGGTCCCCACCTGACCCCGTGCCCCACGCCTGCCCTCCCTGCTCACACCAGTGTTCGCACTTAACTCAGATCCCCGGAAGGAGCGTCAGGCTGCTCAGTGGGAACTAGCGGGTGGCCACGGGGACTCCTCGAGGGTGACCCGTTGCAGGAGCTGCCCCGTGCCGACCTGACTAGGTGTGGGCAAGCCTGCCTGCTCCCCAGGCAGGCCCCCTGGGGACAGGCGGGGTCCTCGGTAGAGCTGGCACCTGACGGGGCTCGCGTCCCGCAGTCCGCACACCCGTGCGGGCCTCGAGGCTGGCCGCCGCTTCGAGCTCACGGCGAGCAAGCTGCTTTTCTCGTGTCGTTTTGTTGCCGAGGTGTGCTAAAGGCCCCATCGCGCCGTCCCTCAGTTAAGCACGGACTCTTCCGCTGTCACTTTCTTTGTCCCTCACACGCAGTGACTTTAATTTCACTTTTGTAGCGTAACCTCGTCACCACGTGCAGTGCAGTTGCGCGCGCAGACACGGGCCGGGAGGGCGAGCCCTGCGTCCTTCCTCCAGTGAACCGCGTTTTACTCACAAATAAAATTCTTTCAGCAGCTCCCTCGTCCGAACCTGGCGAGCACTTTCA