Transcript asmbl_17231

Sequence
Transcript Sequence for observation asmbl_17231 of TGE0000410:
CGCAGGCGGCCGAGCGGGACTGGCTGGGTCGGCTGGGCTGCTGGTGCGAGGAGCCGCGGGGCTGTGCTCGGCGGCCAAGGGGACAGCGCGTGGGTGGCCGAGGATGCTGCGGGGCGGTAGCTCCGGCGCCCCTAGCTGGTGACTGCTGCGCCGTGCCTCACACAGCCGAGGCGGGCTCGGCGCACAGTCGCTGCTCCGCGCGCGCGCCCGGCGGCGCTCCAGGTGCTGACAGCGCGAGAGAGCGCGGCCCTCAGGAGCAAGGCGAATGTATGACAACATGTCCACAATGGTGTACATAAAGGAAGACAAGTTGGAGAAGCTTACACAGGATGAAATTATTTCTAAGACAAAGCAAGTAATTCAGGGGCTGGAAGCTTTGAAGAATGAGCACAATTCCATTTTACAAAGTTTGCTGGAGACACTGAAGTGTTTGAAGAAAGATGATGAAAGTAATTTGGTGGAGGAGAAATCAAACATGATCCGGAAGTCACTGGAGATGTTGGAGCTCGGCCTGAGTGAGGCACAGGTTATGATGGCTTTGTCAAATCACCTGAATGCTGTGGAGTCCGAGAAGCAGAAACTGCGTGCGCAGGTTCGTCGTCTGTGCCAGGAGAATCAGTGGCTACGGGATGAACTGGCCAACACGCAGCAGAAACTGCAGAAGAGTGAGCAGTCTGTGGCTCAACTGGAGGAGGAGAAGAAGCATCTGGAGTTTATGAATCAGCTAAAAAAATATGATGACGACATTTCCCCATCCGAGGACAAAGACACTGATTCTACCAAAGAGCCTCTGGATGACCTTTTCCCCAATGATGAAGACGACCCAGGGCAAGGAATCCAGCAGCAGCACAGCAGTGCAGCCGCGGCTGCCCAGCAGGGCGGCTACGAGATCCCCGCGCGGCTGCGGACGCTCCACAACCTGGTGATCCAGTACGCCTCGCAGGGGCGCTACGAGGTAGCTGTGCCCCTCTGCAAGCAGGCCCTGGAGGACCTGGAGAAGACTTCAGGACACGACCACCCGGACGTGGCCACCATGCTCAACATCCTGGCCTTGGTGTACAGGGATCAGAATAAATACAAAGATGCAGCTAACCTACTGAATGATGCCTTGGCTATTCGTGAGAAAACTTTGGGCAAAGATCATCCTGCGGTGGCGGCGACTTTGAATAACCTTGCAGTCCTTTATGGTAAAAGAGGGAAGTACAAAGAAGCAGAGCCGTTGTGTAAAAGAGCTCTGGAAATCCGAGAAAAGGTTTTGGGGAAGGATCACCCCGATGTTGCCAAGCAGTTAAATAACTTGGCCTTACTGTGCCAGAACCAGGGCAAGTATGAAGAAGTAGAATATTATTATCAAAGAGCCCTCGAGATCTACCAGACAAAACTGGGACCTGATGACCCCAACGTGGCTAAGACGAAAAATAACCTGGCATCCTGCTATTTGAAACAAGGAAAGTTCAAGCAAGCAGAAACACTGTACAAAGAGATTCTCACTCGTGCACATGAAAGGGAGTTTGGTTCTGTAGATGATGAAAATAAACCCATCTGGATGCATGCTGAAGAAAGAGAAGAATGCAAAGGAAAGCAAAAGGATGGGACATCTTTTGGAGAGTATGGCGGCTGGTACAAAGCCTGCAAAGTTGATAGTCCAACTGTTACAACCACTCTAAAAAACCTTGGGGCACTTTACAGACGTCAAGGCAAATTTGAAGCTGCAGAAACGTTAGAAGAAGCTGCTATGAGGTCTCGTAAACAGGGTCTTGACAATGTTCACAAACAGAGGGTGGCAGAAGTGCTCAATGACCCTGAGAACATGGAGAAGCGCAGGAGCCGTGAGAGCCTCAACGTGGACGTGGTCAAGTACGAGAGTGGCCCTGACGGAGGGGAGGAAGTGAGTATGAGCGTAGAGTGGAACGGGGGCGTCTCTGGCCGAGCCTCTTTTTGTGGAAAACGACAGCAGCAGCAGTGGCCTGGAAGACGCCACCGCTAACTGACCCCGACCTGGCCCCGCTCCAGGATGGGACTGCCGAGTGTGGCCCGGAGCTGGCCCGGGACAGCCAGGGCGGCAGGGAGGGCCCCTGGCCGGGAGCCGCAGCGCTCACTCATTTCTCCTGCGTCTGTGTGCATAGGACATGATACTAATAACCACACGGCTGGCGTGACCTTGGGGCTGGGGCTGGGCCTAAGCTGGTGCCCTGGTGCGGCGTGGTCTCTCCCAGGAGACCTGGGGCATGAGCTGGGCCCACGGCTCCCTTCCCATGTGTAACTTCCTCACGTTGTGTGCGATAACGTATTTTATTGTACATTTTTTTAAATTAAAAGTTTATATGCCTTATGCTTTACTTGAAAGTTTT