Transcript asmbl_18670

Sequence
Transcript Sequence for observation asmbl_18670 of TGE0004038:
AGACAAACTGTCCTTAGTGTTTGGGGACTGGTTTCCAGGTTAGTGTGTTTTCAGAGCCTGAGCGTGCACCTTGGCGGATACGAAATCGGCCGGACTATGTCGGCCTTTGAGAAGCCTCAGATCATCGCTCATATCCAGAAGGGCCTCAACTACACGGTGTTTGACTGTAAGTGGGTGCCCTGCAGCGCTAAATTTGTGACCATGGGCAACTTCGCGCGGGGCACCGGCGTCATTCAGCTGTACGAGATCCAGCACGGAGACCTAAAGCTGCTTCGGGAGATTGAAAAGGCCAAACCTATTAAATGTGGAACATTTGGTGCAACATCTTTACAGCAGAGATATTTAGCTACTGGAGATTTTGCTGGAAACCTTCATATATGGAATTTGGAAGCTCCAGAGATCCCAGTGTATTCTGTAAAGGGCCATAAAGAGATTATAAATACTATAGATGGTGTAGGTGGACTAGGAATTGGGGAAGGAGCACCTGAAATTGTGACTGGCAGCCGAGATGGAACTGTGAAGGTTTGGGACCCAAGGCAAAAAGATGATCCTGTTGCTAATATGGAACCTCTACAAGGAGAAAACAAGAGAGACTGTTGGACTGTGGCATTTGGCAATGCTTATAATCAAGAGGAACGTGTCGTTTGTGCTGGCTACGACAATGGGGATATCAAACTGTTTGATCTCAGAAACATGTCATTGCGGTGGGAGACAAACATTAAAAATGGGGTATGTAGCTTGGAGTTTGACAGAAAAGACATTAGTATGAATAAGTTAGTAGCTACATCTCTGGAAGGGAAGTTTCATGTTTTCGACATGAGAACACAGCATCCAACCAAAGGTTTTGCTTCTGTTTCAGAAAAGGCTCATAAATCTACTGTGTGGCAGGTCCGACACCTGCCACAGAACAGGGAGCTCTTCCTGACAGCCGGAGGCGCCGGCAGCCTTCACCTCTGGAAGTACGAATACCCTGTTCAGAGGTCAAAGAAAGACTCCGAGGGAGTGGACATGGGAGTTGCGGGTTCGGTCCGCCTTCTGCAGAATGTTACACTGTCTACCCAGCCCATTTCCAGTCTGGACTGGAGTCCAGATAAAAGGGGTCTCTGCATCTGTAGTTCATTTGATCAGATGGTAAGAGTACTGATTATTACAAAGCTCCATAAAATTTGATCTGAAGACTTTGGACTTGACATCTTCCAGCAGAACACTCTTAGAATTTAAAAAGTGTTCTGGATTCTCGGACCCTCACTGAACAAAGTTGGATTCGATTGATGAAAAAGACCCTGGACACAAACCTCCAAGCCAGCCTCTCCCTGGGTGTGAAATGCCCAGCAGTGTGTCACGGTGACCTGGCTGCACATGGGGGTGCCACTATCTCCAGAGCCAGCTGTTTTTTCCATTTCTCATAAAAAATTGCTACTTGTCTATATTCAAACATATTTTAAATTTGTTCTGCATCCCCAGAGTTCCATATTTTATAATAACATTTGTGTTGCATTTTAGCGTTTACAGTGTTGTGGTGGGGGTCACTTAATTTGGTTTAAAGTTTGCCTTGGTAGAACTGCTGTGAATTAACTTTCATAAATACACTTTGAGAGGTTTCAGTGTCACTAAGTTTCAGTACAGAATATTACATTATACAATCCCAAAGTGGCACCTTCAGACTAGATTTAGGTAGCTGTTTTTTAGTAGTGTAACTCTTAAAATGAAATACTACGATTTACAAAGACCTCTTTTTCACTTAAAAAACAAGAGTTGTATTAGTGAGACTTTGGATGGTAAGTCTCACTTATGGTGAGTGATGTTGAATGTTGAGATGTACAAGATTGTGGGTTTTGTAGCCTTATTTTTTG