Transcript asmbl_18633

Sequence
Transcript Sequence for observation asmbl_18633 of TGE0004029:
TGGAGACCTTCAGGCGGAGCGCGGGTCTCTAGGAGCTATGGGGCACGCCCGGGATTTCGTCTGGGCGCTTCTGGGGCTGTGGCTGCTACTGTGCAGCTGGAGTTGCCTCGGGAGCGCCGAGCTGCGTGCTCCGCCGGATAAGATCGCGATTATTGGAGCTGGAATTGGTGGCACTTCGGCAGCCTATTATCTGCGGCAGAAATTTGGAAAAGATGTGAAGATTGACCTGTTTGAAAGAGGAGAAGTTGGGGGCCGTCTAGCCACCATGACTGTGCAGGGGCAAGAATATGAGACAGGAGGTTCAGTCATCCATCCTTTAAACCTACACATGAAGCGCTTTGTCAAAGACCTGGGTCTCTCTGTTGTCCAGGGTTCTGGTGGCCTAATTGGGGTGTATAACGGAGAGAGTCTGGTGTTTGAGGAGAGCAGCTGGTTTATAATTAACATAATTAAACTAATCTGGCAGTATGGATTTCAGTCCCTTCGAATGCACATGTGGGTAGAGGATATATTAGACAAGTTTATGAGGATCTACCGCTACCAGTCTCATGATTATGCCTTCAGTACTGTAGAAAATTTACTGCATTCTCTAGGAGGGGACGACTTCCTTGGAATGCTTAACCGAACACTTCGTGAAACCTTGCAGAAAGCAGGCTTCTCTGAGAAATTCCTCGATGAAATTGTTGCTCCTGTCATGAGGGTCAATTATGGCCAAAGCACAAACATCAATGGTTTTGTGGGGGCAGTGTCACTAGCTGGTGCTGATTCTGGCCTTTGGGCAGTAAAAGGTGGCAATAAACTTATTTGCTCAGGGCTCCTTCAGGCTTCCAAAGGCAACCTTATATCTGGCTCAGTAATGTACATAGAGGAGAAAACACGGACCAAGCAGACAGGAACCCCCGCAAAGATGTACGAAGTGGCCTACCAAACTGGATCTGAGACCCATTCAGACTTTTATGACATCATCGTGGTGGCCACTCCATTGAATCGAAAAATGTCCAATATAACTTTTCTCAACTTTGATCCTCCAATTGAGGAATTCCATCAATACTACCAATATATTGTGACAACTTTAATTAAGGGGAACTTGAATTCCACTATTTTTAGCTCCAGAGCCTTAGGTAAATTTGATCTCAGTACAATCTTAACCACTGATAATTCAGATTTGTTCATTAACAGCATTCGGATTGTGTCCTCTGTAAGAGAAAATAATCCTCAACCATCAGAAGATGGGGCATATGTTTGGAAGATCTTTTCCCAAGAAACTCTTACTAAAGAACAAATTTTAAAGCTCTTTTTGTCCTATGATTATGCTGTGAAGCAGCAGTGGCTTGCATATCCTCACTATAAGCCTCCAGAGAAATGCCCCTCTATCATACTTCACGATCGACTTTATTACCTCAGTGGCATAGAGTGTGCAGCAAGTGCCATGGAGATGAGTGCCATTGCAGCCCACAATGCCGCTCTCCTTGCCTATCACCGCTGGAATGGACATACAGATATGATTGACCAAGAGGATTTATATGAGAAACTTAAAACTGAACTATGAAATAATAACACTTTCACTTTTCCCCCCTCTTGGTTCCCAGTGGAATATCACTGGCAAAAAAGAACACAATCTGAGCAGAGATGTTTTCAAATCACATATTTTGCCATTATTGTTTAACATGAGTAATTCTAGTGTCATGAGAAAATATAAGGATCTCATAAGCGTGAAAGTGTAACTACTGCACTTATCCCATCTCCAAAATTTCTTAACTCTTCTTTTAATACCCATCAGCAGTGTTTCCCAAACTTGTTTGATCGTAAGAATCATTTGAGGTTTGATAAACATATAAAATTCTCTAGCTCTTCTGGAGATTGATTCAGTAGGTCTGGAGATGAGGCCCTGGATTTTGAATAAAATCTTAGAACATTTGAAGCTGAACACTTGAATTAGAACTTAAGACACGTTTTAGTTGGGGACTAGTTTATTTGTACTTCACAGCTGGATGTGATCTTGAGTCAGATAGTTAAAACTGCTGTAGGAGTTGGTATCTTATGCCTGGCTTTAGTAATTTATACTCTTTTTCAAAGTAAATGCCTCACCGAAGCCTTGACTTTCAGAATGTTTTTTTGATTTCTTCTGTCTCATTTTTTAAGGGTGAAATTTGTAAGTCTTAGTAGTATAACTTTAAGATGTCTTACAAAAGTCTCTAGTAAAATGAAAAGCAAATATAGGCTCATTGAAGAAATTGGCATTCAATTATCGAATCCTCACCCACGTATTTAGAAAATACTGATATACCCTATAGATTATTTAATGGACTGAGGATAGGACCTCCGCATTGTAGCTTGTTAAAAGTTCCTGATGTGCAGCCTGGGTCGAGAATCACTGACTTGGAGAGTCTAATATGTTTCCAAAGGGTTTTTCAGTGCCTTCAAAGTCCCAAGAAATCCAATTCATTATCAAAGCAGATGGATTTTGTGAAGAATTTCTCAGAACTCTAGTGGTAACCTTGATAGTAAGCAGCATTGACAGCCTAACAGCAGAGGTAACTTGGATTACTCCAGAGTTGACACAAGTAAGATACTCGTAATGACACCATGCTTGATCAAATCCAGCATATGTCCAAACTGTTAAATGCTTCTAAAGCTACTGGTACCATTTTGGGTGAGAAATTGGTTCCTGAAATCTTTTAATGCGTTAAGTTCTCAACCTTGGCTGCACATTGGAATCTTCTGTTGGACTTTAAAGCTTCCCAAATGATTCTAATATGCAGCCAAGCTTGAGAATCAGTTCTACATCTACTGTATTAAGATCATTAATGACTGTCCTTATAGTCACTGTTAGGACAGAACACATAAAAGCTTGTGAATTCAACAGTAACAGCAACAAAGTTAACATGTACTGTTAAAAAAATTTGTCAAAGGTTTTTTTTTCTAATTTTATTTTTAAAAAGAATGTTGAGGCAATTTTCTTTTCCTTTTGTGGTTTTAATGGACAGTATGCGGAGAATGTAATATACTGTGCTATGTATATGCTAGACTGGTAAATACTAATAGTTAACTTAGAACTTGTTTTGCAATGGGATATATGTCAAGCATATTTGTTTTAATGCAATCATGGTATTAAAGGATATATGTATTTTTTATTGGACAAAAAATACTATCAGAGCTTGTTACTCCAGAAGACCACTCATCCTTTTACAGAAGAGAATGGTAAAGGGCTGAATGAAAGCCAGCTCCACTCTAGTGGTTCTCCGACTTAGGTATGCATCAGACTTACCCGGTGGGCTTGTTAAAACATTTCTGGGCTTACCCCCAGAATGTGTTTTAATAGGGTTTGGGGTGGCATACAAAAATTTGCATTTCTGTTAAGTTCCTAGGTGATGTTCCTGGTCTAGGAACCACACTTAAAAGAGAACTAGTTCTGTAATTCAGCTCTAAGTGGTTGAAAAATTGAAAGCCTGTCAGCTTCAATGAAGATTTAAAAAGAGCTACTGGAGAAGAATGTTAGAATAAAAATGTTGGACTTCACACCAGCTCTCCTTATTGTGATTAGGTTGGTTTGAACCCTCTAGCTGTTCTTTTGCTGTAAATAGGAAATATTATTTTAGAGCTACATCAGGTGTGCTCACTGTATACCCCATTCTCTGCAGTTTTAAAGTGACTCAAGATTTGTAGTATTTTTACCAGATCACAAAAAGAACAGGTCTAGTCATTTACTTGGTAGGTTTCTTAAGGTTAGGCTTATGATACAACCATCTGTATGTAATATAGCTTTCATCAGTTGGTGTGCCCTCAAATGTATGAACTAGATGAATGTATTATGGCAGCATCATCATTACTCTCTATACTTTACAAAGAACAATACACTGGAATGTTTTTCTCTGGAATTCTATTTCTACTCTTGTATTAAAAATTTTTTCCCACTTATGTTCGAAATAAACAACTACATCATTAA