Transcript asmbl_54454

Sequence
Transcript Sequence for observation asmbl_54454 of TGE0006025:
GCGGCTTCCGCTACGCCCTGACAACAGCGGGGTCTCTGACTACGCTGGGGTGGGCTACCGTGGGCCTCCGGGCGGCGGTCAACGATGCTGAAGGCCAAGATCCTCTTCGTGGGGCCCTGCGAGAGTGGAAAAACCGTTTTGGCCAACTTCCTGACAGAATCTTCTGACATCACCGAATACAACCCAACCCAAGGAGTGAGGATCCTGGAGTTTGAGAACCCACATGTTACCAGCAACAACAAAGGCACCGGGTGTGAATTTGAACTATGGGATTGTGGCGGTGATCCAAAATTTGAGTCTTGCTGGCCAGCCTTGATGAAGGACTCTCACGGAGTGGTGATCATCTTCAATGCTGACATCCCAAGCCACTTGAAGGAAATCGAGATGTGGTATTCCTGCTTTGTCCAGCAGCAGTTCCTGCAGGATACTCAGTGTCTGTTAATTGCACACCACAAACCAGGCTCTGGAAGTGGTAAAGGAAACCTATCTTTGTCGCCACCCTTGAACAAGCTGAAGCTGGTACACTCAAATCTTGAGGATGACCCTGAAGAGATCCGGATGGAATTCATAAAGTATTTAAAAAGCATAATCAACTCAGTGTCTGAGAGCAGAGACCGGGAGGAGATGTCCATTATTACCTAACCAGCCTTCATCTGGACTCTTCTGCATCCCAAGTGAGGTCAACTTCTTTCCCAGTGCAGATCTGAAATCTTACCCAGTTACTGATGTTTTCTTCTCCCAATGGCCCTTGAAAAAATTTTCCTTCCCTGCTTGCAGGTACCAGTTGCCCAGGGAGTTGAATCATACAATCTAAGCCCTGTCCTTAGTTCAGGTGAGAAAATCCTGTTACTGAATTTTGATTTCTTTGCCCCAGGTTGCTTCAAAGAGCTGGAAAACTGAGGTGTTTTGTTTTCCCCTTCACATATGTCAAGTTATAAAACTTGTGGAATTGTAACTGTCATAGCCTAATCCATGCGTATTGGTTTGAATGTGATTTTCATTTCTTAATTCACTCAACAAATAGCGACTTGTTGAGCATCTACTATTGGCTACACTGTTCTAGTTGCAGACAGTATACAGCATGAACAAAATAAAAACCCTTGCTCTCATGGAACTTCTATTATAAAAAAATAGTGAGGTAGTCAAAAACTGAATTACTATACCTTGGATATGCAAAAAAAAAATATTATGGATTCTTCTTTTCTGTAATTGGTCTAACTCTAATGCACCTACCCTCCTAGATAATTAACAGACTTGGAGTATGTAACATGCAAAGGAAGGTACAGTCAGTCCTCATTCATGGATTTTGTATTTGCGAATTTGCCTACTTGCTAAAATTTATTTGTAACCCCCAAATCAATACTCACAATGCTTTGACAGTTATTCAGAGTGGCAAAAAATTTGAATCACTGGATACGCACATTCCCAACTGAGGCCGAAACAAGAAGGCAGCGCTCTGCCTTCTTGTTTCAGCTGTTGTATTGTAAACCAGTGTCCTTGTTGTGGTATATTTAGTACCACTTTTTCATATTTTTGTGCTTCTCATTGGTTATTATTTTGTTGGTTATTAAAATGCCCCTCCCCCCAAACGTAGTGCTGAAGTGCTGTCTGGTGGTTCCTAAGCACAAAAAGGCTGTGATGTGCCTTATGATGAAAATAGATATGTTAGATAAGCCTCATTCCAGCATGAATTATAGTGCTGTTAGTTGTGAGTGCAGTGTTAATCAACAACATATATTAAATAAAGTATCTTTAAACAGAAGCATACAGAAAATAAAGTTATGTATTAATAGTTGAAAATATTGTGATCAGAGGCACGCAGGAACCTAACCCTGTATTTCCCTGGGAGAAATGCTTTGGTGTTCATTAATCCATTGTTTGTGGTAACATTACAGAACATAATGACCATGAATAATGAGAATCCACTGTATTTCCATCTCTTGCAATTTAAATGTTTTCAGGTTAGTTCAGCCTCTAATAAATATTTAATTAATTCAAAATTACAATCCACTTCCTCTACATTCTCCCCAACATGATATCATGGTGTCGGGACAGT