Transcript asmbl_18597

Sequence
Transcript Sequence for observation asmbl_18597 of TGE0004025:
GGCGGCGGCGTGCGGGGCCCCACGGTGTAAACAGCCCCGGAGGCGGCGACCGAGACCCCGAGAGGGAAGCGGCAGCTGAGGCAGGGTCCTCGGTTGGAAGCCTGGGCTGAGTGCAGCTGGGAGCCTCTGCGGCGGCGTGAGCAGACGCCCTAGACCTCGCCTCCCTCCCTTGCCCCAGATTTATTACTAAACATGGGTGCATTTTTGGATAAACCCAAAACTGAGAAACATAATGCTCATGGTGCTGGGAATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTAGAAATGGAAGATGCACACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATGATGGTCATGCTGGATCCCGAGTAGCAAATTACTGCTCAACACATTTACTAGAACACATCACTAATAATGAAGACTTCAGGGCAACTGGAAAATCAGGATCTGCTCTTGAGCCTTCAGTGGAAAATGTCAAGAATGGTATCAGAACTGGCTTTTTGAAAATTGATGAATACATGCGTAACTTTTCAGACCTCATTAGCGGTTCAACTGCAGTGGGAGTTATGATTTCACCTAAGCATATCTACTTCATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATGGACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAGAAGGAGCGAATCCAAAATGCAGGAGGCAGTGTAATGATTCAACGTGTTAATGGTTCATTAGCAGTATCTCGAGCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTGTTTCTCCAGAGCCTGAGGTTTATGAACTTTTAAGAGCAGAAGAGGATGAATTTATCATCTTGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATTTGTTAAATCTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTTTACATAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCCCCCAAGGTCTCAGAAGAAGCAGTGAGAAAAGATTCAGAGTTGGATAAATACTTGGAATCACGGGTTGAAGAAATTATGGAGAAGTCGGGTGAGGAAGGAATGCCTGATCTTGCCCATGTAATGCGCATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGCGCAATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACACAGAGAAAGTGATGGGGGTGCTGGAGATCTAGAAGACCCATGGTAGCCTTATAAACCTTCTAAAATGCTTTTGATTCTGAAAATTGGGGGAAAAAACTTTTAATCACAATTTTCTTCAATACAAGGGAAAAATATTCTTGTGGATTTCCAACGTTTTGTGATATGAGCAGAAAATAATTAGCATTTCCCATCATTTGTTCATATTTGTGTTTTCTGATAATTGCCACTTTGTAGCATTGCCTGTACTACAGTATTTTTGCCAACCTCAGGCATACTGGTTACATCTGTATTGAACTTTTGGCCCTAGAAACCAATGAAGTTATTTCAGCACATATAATAATTGTGCCTGAGGTGCATGGGAATATAGTTAGCTGTACTCCGAAGATACATTATGGGGTTTTTTTGTTGTTGTTTTTTGTTTTTGTTTTTTTTAACAAGACACACAACATATAAGCATGTAAGAGTAAAGAATTATACGAGATGTTCCTTTTTTCAATTCACCAAGTTGGAAGCCTTTTGCAGCTCTGTGGCTTGAAATTTCATTTGAGCATACTGTAGGATATATATTTATTATTAATTGTTATTTAATTTTTTTTTCCAATTTTACCTGTATTACCAAACTGGGTTCTCCAATAATGTCCAAATTGTAATGTTGCCTGCTTCAAGATAAAGTGTATTTGGCAATAATAATAAAACCCTTACAGGTTTTATGCATGTATTTACTACATCCTTCAATTCTCACTAGAAAATCTTTGAAACCAAATGGATTAATTTATGGCTATTTATAATTTGCTTTGACATCTCACTGCTGCAAATTTTTTAAATGATGAAATTTGCCTTTATAATGTAAATTGTGATTTTTGTTTTAAATGTGGG